\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136277359:

Variant ID: vg0136277359 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 36277359
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATGACAGTTGCTGTTCCTTTAAGGTCATGAGCACTCGGTTTGGAAATACTCCTCCGTTCCTTTAAAAAAAAATTTAATCTACAAAGAGATGTGACCCCTA[C/T]
TAAGATAACGAATATGTACGAATGATAGTTTAGATTCATTATACTCTGGTTTTAGACCCTTGTATTTTTCACTATAGTCTACACATTAACCAAAATACAT

Reverse complement sequence

ATGTATTTTGGTTAATGTGTAGACTATAGTGAAAAATACAAGGGTCTAAAACCAGAGTATAATGAATCTAAACTATCATTCGTACATATTCGTTATCTTA[G/A]
TAGGGGTCACATCTCTTTGTAGATTAAATTTTTTTTTAAAGGAACGGAGGAGTATTTCCAAACCGAGTGCTCATGACCTTAAAGGAACAGCAACTGTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 46.10% 0.19% 0.00% NA
All Indica  2759 27.10% 72.60% 0.25% 0.00% NA
All Japonica  1512 98.20% 1.80% 0.00% 0.00% NA
Aus  269 56.50% 43.50% 0.00% 0.00% NA
Indica I  595 12.10% 87.70% 0.17% 0.00% NA
Indica II  465 5.20% 94.80% 0.00% 0.00% NA
Indica III  913 41.90% 57.90% 0.11% 0.00% NA
Indica Intermediate  786 34.20% 65.10% 0.64% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0136277359 C -> T LOC_Os01g62640.1 upstream_gene_variant ; 2626.0bp to feature; MODIFIER silent_mutation Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0136277359 C -> T LOC_Os01g62650.1 upstream_gene_variant ; 1594.0bp to feature; MODIFIER silent_mutation Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0136277359 C -> T LOC_Os01g62650.2 upstream_gene_variant ; 1594.0bp to feature; MODIFIER silent_mutation Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0136277359 C -> T LOC_Os01g62640-LOC_Os01g62650 intergenic_region ; MODIFIER silent_mutation Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0136277359 NA 1.97E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359 NA 1.89E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359 NA 9.05E-32 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359 NA 1.23E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359 2.47E-06 2.11E-10 mr1887 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359 NA 2.94E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359 NA 2.67E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359 NA 1.33E-06 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359 NA 3.09E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359 NA 1.64E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359 NA 6.29E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251