\
| Variant ID: vg0136277359 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 36277359 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )
ATGACAGTTGCTGTTCCTTTAAGGTCATGAGCACTCGGTTTGGAAATACTCCTCCGTTCCTTTAAAAAAAAATTTAATCTACAAAGAGATGTGACCCCTA[C/T]
TAAGATAACGAATATGTACGAATGATAGTTTAGATTCATTATACTCTGGTTTTAGACCCTTGTATTTTTCACTATAGTCTACACATTAACCAAAATACAT
ATGTATTTTGGTTAATGTGTAGACTATAGTGAAAAATACAAGGGTCTAAAACCAGAGTATAATGAATCTAAACTATCATTCGTACATATTCGTTATCTTA[G/A]
TAGGGGTCACATCTCTTTGTAGATTAAATTTTTTTTTAAAGGAACGGAGGAGTATTTCCAAACCGAGTGCTCATGACCTTAAAGGAACAGCAACTGTCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 46.10% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 27.10% | 72.60% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 12.10% | 87.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 41.90% | 57.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 34.20% | 65.10% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 30.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0136277359 | C -> T | LOC_Os01g62640.1 | upstream_gene_variant ; 2626.0bp to feature; MODIFIER | silent_mutation | Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432 | N | N | N | N |
| vg0136277359 | C -> T | LOC_Os01g62650.1 | upstream_gene_variant ; 1594.0bp to feature; MODIFIER | silent_mutation | Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432 | N | N | N | N |
| vg0136277359 | C -> T | LOC_Os01g62650.2 | upstream_gene_variant ; 1594.0bp to feature; MODIFIER | silent_mutation | Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432 | N | N | N | N |
| vg0136277359 | C -> T | LOC_Os01g62640-LOC_Os01g62650 | intergenic_region ; MODIFIER | silent_mutation | Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0136277359 | NA | 1.97E-07 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136277359 | NA | 1.89E-07 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136277359 | NA | 9.05E-32 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136277359 | NA | 1.23E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136277359 | 2.47E-06 | 2.11E-10 | mr1887 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136277359 | NA | 2.94E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136277359 | NA | 2.67E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136277359 | NA | 1.33E-06 | mr1364_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136277359 | NA | 3.09E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136277359 | NA | 1.64E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136277359 | NA | 6.29E-08 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |