| Variant ID: vg0136191693 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 36191693 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGTTGGATCCGTCACCACTAATCATCGTCTCCTAACCATAAGCTCTGGTTTGCCCCCGTCATCAAGGCCAACCCATCATCCTCCTCCATCTCCGTGGCTT[C/T]
GATGTGGCCGCCGATGCCTCACCTCCAACTCGTGTCTACCTCCCACTGTCGGGCCGTTGCCTCCGACATCTCTTTAAGCATGGCGATGTCCCTCTTCTTT
AAAGAAGAGGGACATCGCCATGCTTAAAGAGATGTCGGAGGCAACGGCCCGACAGTGGGAGGTAGACACGAGTTGGAGGTGAGGCATCGGCGGCCACATC[G/A]
AAGCCACGGAGATGGAGGAGGATGATGGGTTGGCCTTGATGACGGGGGCAAACCAGAGCTTATGGTTAGGAGACGATGATTAGTGGTGACGGATCCAACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.90% | 1.90% | 1.23% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.50% | 5.70% | 3.84% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 87.40% | 5.30% | 7.30% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.50% | 13.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0136191693 | C -> T | LOC_Os01g62500.1 | upstream_gene_variant ; 3695.0bp to feature; MODIFIER | silent_mutation | Average:72.374; most accessible tissue: Zhenshan97 young leaf, score: 86.698 | N | N | N | N |
| vg0136191693 | C -> T | LOC_Os01g62510.1 | upstream_gene_variant ; 12.0bp to feature; MODIFIER | silent_mutation | Average:72.374; most accessible tissue: Zhenshan97 young leaf, score: 86.698 | N | N | N | N |
| vg0136191693 | C -> T | LOC_Os01g62514.1 | downstream_gene_variant ; 2147.0bp to feature; MODIFIER | silent_mutation | Average:72.374; most accessible tissue: Zhenshan97 young leaf, score: 86.698 | N | N | N | N |
| vg0136191693 | C -> T | LOC_Os01g62510-LOC_Os01g62514 | intergenic_region ; MODIFIER | silent_mutation | Average:72.374; most accessible tissue: Zhenshan97 young leaf, score: 86.698 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0136191693 | NA | 4.26E-07 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136191693 | 1.07E-08 | 2.64E-10 | mr1114 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136191693 | 3.23E-07 | 5.52E-08 | mr1116 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136191693 | 5.29E-09 | 1.73E-11 | mr1117 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136191693 | 3.44E-06 | 4.90E-09 | mr1118 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136191693 | 2.39E-07 | 8.63E-08 | mr1119 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136191693 | 6.85E-08 | 1.43E-10 | mr1123 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136191693 | 1.61E-09 | 1.41E-11 | mr1240 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136191693 | 3.80E-07 | 2.18E-09 | mr1242 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0136191693 | 3.65E-09 | 1.01E-10 | mr1247 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/