\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136191693:

Variant ID: vg0136191693 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 36191693
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTTGGATCCGTCACCACTAATCATCGTCTCCTAACCATAAGCTCTGGTTTGCCCCCGTCATCAAGGCCAACCCATCATCCTCCTCCATCTCCGTGGCTT[C/T]
GATGTGGCCGCCGATGCCTCACCTCCAACTCGTGTCTACCTCCCACTGTCGGGCCGTTGCCTCCGACATCTCTTTAAGCATGGCGATGTCCCTCTTCTTT

Reverse complement sequence

AAAGAAGAGGGACATCGCCATGCTTAAAGAGATGTCGGAGGCAACGGCCCGACAGTGGGAGGTAGACACGAGTTGGAGGTGAGGCATCGGCGGCCACATC[G/A]
AAGCCACGGAGATGGAGGAGGATGATGGGTTGGCCTTGATGACGGGGGCAAACCAGAGCTTATGGTTAGGAGACGATGATTAGTGGTGACGGATCCAACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 1.90% 1.23% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 90.50% 5.70% 3.84% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 87.40% 5.30% 7.30% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 85.50% 13.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0136191693 C -> T LOC_Os01g62500.1 upstream_gene_variant ; 3695.0bp to feature; MODIFIER silent_mutation Average:72.374; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0136191693 C -> T LOC_Os01g62510.1 upstream_gene_variant ; 12.0bp to feature; MODIFIER silent_mutation Average:72.374; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0136191693 C -> T LOC_Os01g62514.1 downstream_gene_variant ; 2147.0bp to feature; MODIFIER silent_mutation Average:72.374; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0136191693 C -> T LOC_Os01g62510-LOC_Os01g62514 intergenic_region ; MODIFIER silent_mutation Average:72.374; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0136191693 NA 4.26E-07 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 1.07E-08 2.64E-10 mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 3.23E-07 5.52E-08 mr1116 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 5.29E-09 1.73E-11 mr1117 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 3.44E-06 4.90E-09 mr1118 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 2.39E-07 8.63E-08 mr1119 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 6.85E-08 1.43E-10 mr1123 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 1.61E-09 1.41E-11 mr1240 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 3.80E-07 2.18E-09 mr1242 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 3.65E-09 1.01E-10 mr1247 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 1.31E-10 4.12E-13 mr1496 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 NA 2.46E-08 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 6.68E-08 5.52E-10 mr1917 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 1.42E-07 1.02E-09 mr1936 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 4.51E-07 1.06E-07 mr1961 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 3.50E-07 1.44E-10 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 7.90E-06 3.59E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 7.73E-08 4.83E-10 mr1117_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 5.50E-06 4.18E-09 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 7.35E-07 3.34E-09 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 NA 1.48E-07 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 NA 1.21E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 1.81E-06 5.48E-09 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 9.52E-06 2.67E-08 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 3.97E-06 2.17E-08 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 NA 7.35E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 1.63E-07 2.34E-10 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 NA 1.10E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136191693 4.22E-06 NA mr1961_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251