\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136060970:

Variant ID: vg0136060970 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 36060970
Reference Allele: GAlternative Allele: T,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, T: 0.21, A: 0.02, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGATCTCTGAAATGATAAATCAGGTTTATTTTGCAATAACAAAAGATCAAACCAGCAAGATACTTCCTCCATCTAAATATAAGTGCAACTTTAGTACA[G/T,A]
ATATGATATAAGGTGTATTTAATTCTTTGGGTGTAAAGTTTTTGAAGTATACGGACGCACATTTGAAATATTAAACGTAGACTAATAACAAAACAAATTA

Reverse complement sequence

TAATTTGTTTTGTTATTAGTCTACGTTTAATATTTCAAATGTGCGTCCGTATACTTCAAAAACTTTACACCCAAAGAATTAAATACACCTTATATCATAT[C/A,T]
TGTACTAAAGTTGCACTTATATTTAGATGGAGGAAGTATCTTGCTGGTTTGATCTTTTGTTATTGCAAAATAAACCTGATTTATCATTTCAGAGATCCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 48.00% 0.21% 0.02% A: 0.06%
All Indica  2759 73.40% 26.20% 0.33% 0.04% A: 0.04%
All Japonica  1512 2.00% 98.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 87.70% 11.40% 0.84% 0.00% NA
Indica II  465 94.40% 5.40% 0.22% 0.00% NA
Indica III  913 59.10% 40.60% 0.11% 0.00% A: 0.11%
Indica Intermediate  786 66.80% 32.80% 0.25% 0.13% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 43.30% 53.30% 1.11% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0136060970 G -> T LOC_Os01g62310.1 upstream_gene_variant ; 1336.0bp to feature; MODIFIER silent_mutation Average:37.48; most accessible tissue: Callus, score: 67.99 N N N N
vg0136060970 G -> T LOC_Os01g62310-LOC_Os01g62320 intergenic_region ; MODIFIER silent_mutation Average:37.48; most accessible tissue: Callus, score: 67.99 N N N N
vg0136060970 G -> A LOC_Os01g62310.1 upstream_gene_variant ; 1336.0bp to feature; MODIFIER silent_mutation Average:37.48; most accessible tissue: Callus, score: 67.99 N N N N
vg0136060970 G -> A LOC_Os01g62310-LOC_Os01g62320 intergenic_region ; MODIFIER silent_mutation Average:37.48; most accessible tissue: Callus, score: 67.99 N N N N
vg0136060970 G -> DEL N N silent_mutation Average:37.48; most accessible tissue: Callus, score: 67.99 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0136060970 NA 2.01E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 8.66E-09 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 2.18E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 2.53E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 1.17E-13 mr1232_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 3.88E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 6.72E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 1.80E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 1.62E-19 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 1.37E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 4.59E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 3.71E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 2.20E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136060970 NA 3.78E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251