\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135957843:

Variant ID: vg0135957843 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35957843
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CGTAAGCAAATGAGGATCAAGCTTAAAATATATGGATACAACTTTGGCAGACAATATCCATTTGCTAAGGGGCTGTTTGGTTTCCAGGGACTTATTCCAA[A/G]
TCCCTGTCACATCGGATGTTTGGACACTAATTTAGAGTATTAAACATACACTAATTACAAAACCCATTTCATAACATTGGACTAATTTGCGAGACGAATC

Reverse complement sequence

GATTCGTCTCGCAAATTAGTCCAATGTTATGAAATGGGTTTTGTAATTAGTGTATGTTTAATACTCTAAATTAGTGTCCAAACATCCGATGTGACAGGGA[T/C]
TTGGAATAAGTCCCTGGAAACCAAACAGCCCCTTAGCAAATGGATATTGTCTGCCAAAGTTGTATCCATATATTTTAAGCTTGATCCTCATTTGCTTACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.10% 2.80% 0.25% 62.84% NA
All Indica  2759 2.30% 0.70% 0.29% 96.77% NA
All Japonica  1512 97.90% 0.00% 0.00% 2.05% NA
Aus  269 0.70% 40.90% 0.00% 58.36% NA
Indica I  595 1.20% 0.00% 0.67% 98.15% NA
Indica II  465 1.90% 0.00% 0.00% 98.06% NA
Indica III  913 1.30% 0.30% 0.00% 98.36% NA
Indica Intermediate  786 4.50% 1.90% 0.51% 93.13% NA
Temperate Japonica  767 98.80% 0.00% 0.00% 1.17% NA
Tropical Japonica  504 97.20% 0.00% 0.00% 2.78% NA
Japonica Intermediate  241 96.70% 0.00% 0.00% 3.32% NA
VI/Aromatic  96 18.80% 0.00% 4.17% 77.08% NA
Intermediate  90 53.30% 4.40% 0.00% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135957843 A -> G LOC_Os01g62110.1 upstream_gene_variant ; 4336.0bp to feature; MODIFIER silent_mutation Average:34.465; most accessible tissue: Minghui63 root, score: 58.187 N N N N
vg0135957843 A -> G LOC_Os01g62110-LOC_Os01g62120 intergenic_region ; MODIFIER silent_mutation Average:34.465; most accessible tissue: Minghui63 root, score: 58.187 N N N N
vg0135957843 A -> DEL N N silent_mutation Average:34.465; most accessible tissue: Minghui63 root, score: 58.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135957843 4.08E-06 NA mr1570 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135957843 NA 5.74E-09 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135957843 NA 5.55E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251