\
| Variant ID: vg0135939815 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 35939815 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGCTTTTTCACCATTTCCTTTGCATTGCCTTTTGGTGCCCGTTCGCTGTTCTTCTTGTCGTCTGTTCTAGCCCATTCTCCGCTGTTGTGCTTTCTTCGTT[T/C]
GATCATGGACCCTGGGGGGTGAACGCGTGTGCTGGTGGGTTTTCTGTATCTGGCCTAGCTGCCTTCCTTTCTGTCTGTGCCGTGTGTTTCCTTTTTATCC
GGATAAAAAGGAAACACACGGCACAGACAGAAAGGAAGGCAGCTAGGCCAGATACAGAAAACCCACCAGCACACGCGTTCACCCCCCAGGGTCCATGATC[A/G]
AACGAAGAAAGCACAACAGCGGAGAATGGGCTAGAACAGACGACAAGAAGAACAGCGAACGGGCACCAAAAGGCAATGCAAAGGAAATGGTGAAAAAGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.10% | 11.10% | 28.59% | 24.14% | NA |
| All Indica | 2759 | 5.40% | 10.80% | 44.40% | 39.43% | NA |
| All Japonica | 1512 | 97.90% | 0.50% | 0.73% | 0.86% | NA |
| Aus | 269 | 5.60% | 49.80% | 35.69% | 8.92% | NA |
| Indica I | 595 | 3.70% | 12.90% | 37.98% | 45.38% | NA |
| Indica II | 465 | 3.20% | 6.00% | 40.00% | 50.75% | NA |
| Indica III | 913 | 6.40% | 10.20% | 50.27% | 33.19% | NA |
| Indica Intermediate | 786 | 6.90% | 12.60% | 45.04% | 35.50% | NA |
| Temperate Japonica | 767 | 98.80% | 0.10% | 0.39% | 0.65% | NA |
| Tropical Japonica | 504 | 97.20% | 0.40% | 1.19% | 1.19% | NA |
| Japonica Intermediate | 241 | 96.70% | 1.70% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 16.70% | 79.20% | 2.08% | 2.08% | NA |
| Intermediate | 90 | 52.20% | 13.30% | 18.89% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0135939815 | T -> DEL | N | N | silent_mutation | Average:19.305; most accessible tissue: Callus, score: 58.114 | N | N | N | N |
| vg0135939815 | T -> C | LOC_Os01g62090.1 | upstream_gene_variant ; 1284.0bp to feature; MODIFIER | silent_mutation | Average:19.305; most accessible tissue: Callus, score: 58.114 | N | N | N | N |
| vg0135939815 | T -> C | LOC_Os01g62100.1 | upstream_gene_variant ; 425.0bp to feature; MODIFIER | silent_mutation | Average:19.305; most accessible tissue: Callus, score: 58.114 | N | N | N | N |
| vg0135939815 | T -> C | LOC_Os01g62090-LOC_Os01g62100 | intergenic_region ; MODIFIER | silent_mutation | Average:19.305; most accessible tissue: Callus, score: 58.114 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0135939815 | NA | 1.85E-85 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 6.28E-31 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 2.64E-26 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 3.24E-39 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.23E-19 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 2.05E-50 | mr1599 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 3.15E-77 | mr1613 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.05E-32 | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 6.49E-31 | mr1105_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 4.62E-106 | mr1134_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.43E-18 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 3.14E-31 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 4.30E-19 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.62E-54 | mr1194_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.08E-08 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 8.40E-38 | mr1223_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 2.67E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 8.57E-19 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 2.78E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.50E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 2.77E-21 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.13E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.05E-19 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 3.46E-53 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.86E-15 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 4.21E-122 | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 2.67E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.33E-26 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 8.30E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 6.96E-19 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 3.50E-84 | mr1711_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 4.36E-17 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.67E-20 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 2.63E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | 7.68E-06 | NA | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 3.28E-15 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 4.43E-84 | mr1934_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.09E-14 | mr1986_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135939815 | NA | 1.02E-54 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |