\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135939815:

Variant ID: vg0135939815 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35939815
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTTTTTCACCATTTCCTTTGCATTGCCTTTTGGTGCCCGTTCGCTGTTCTTCTTGTCGTCTGTTCTAGCCCATTCTCCGCTGTTGTGCTTTCTTCGTT[T/C]
GATCATGGACCCTGGGGGGTGAACGCGTGTGCTGGTGGGTTTTCTGTATCTGGCCTAGCTGCCTTCCTTTCTGTCTGTGCCGTGTGTTTCCTTTTTATCC

Reverse complement sequence

GGATAAAAAGGAAACACACGGCACAGACAGAAAGGAAGGCAGCTAGGCCAGATACAGAAAACCCACCAGCACACGCGTTCACCCCCCAGGGTCCATGATC[A/G]
AACGAAGAAAGCACAACAGCGGAGAATGGGCTAGAACAGACGACAAGAAGAACAGCGAACGGGCACCAAAAGGCAATGCAAAGGAAATGGTGAAAAAGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 11.10% 28.59% 24.14% NA
All Indica  2759 5.40% 10.80% 44.40% 39.43% NA
All Japonica  1512 97.90% 0.50% 0.73% 0.86% NA
Aus  269 5.60% 49.80% 35.69% 8.92% NA
Indica I  595 3.70% 12.90% 37.98% 45.38% NA
Indica II  465 3.20% 6.00% 40.00% 50.75% NA
Indica III  913 6.40% 10.20% 50.27% 33.19% NA
Indica Intermediate  786 6.90% 12.60% 45.04% 35.50% NA
Temperate Japonica  767 98.80% 0.10% 0.39% 0.65% NA
Tropical Japonica  504 97.20% 0.40% 1.19% 1.19% NA
Japonica Intermediate  241 96.70% 1.70% 0.83% 0.83% NA
VI/Aromatic  96 16.70% 79.20% 2.08% 2.08% NA
Intermediate  90 52.20% 13.30% 18.89% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135939815 T -> DEL N N silent_mutation Average:19.305; most accessible tissue: Callus, score: 58.114 N N N N
vg0135939815 T -> C LOC_Os01g62090.1 upstream_gene_variant ; 1284.0bp to feature; MODIFIER silent_mutation Average:19.305; most accessible tissue: Callus, score: 58.114 N N N N
vg0135939815 T -> C LOC_Os01g62100.1 upstream_gene_variant ; 425.0bp to feature; MODIFIER silent_mutation Average:19.305; most accessible tissue: Callus, score: 58.114 N N N N
vg0135939815 T -> C LOC_Os01g62090-LOC_Os01g62100 intergenic_region ; MODIFIER silent_mutation Average:19.305; most accessible tissue: Callus, score: 58.114 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135939815 NA 1.85E-85 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 6.28E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 2.64E-26 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 3.24E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.23E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 2.05E-50 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 3.15E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.05E-32 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 6.49E-31 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 4.62E-106 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.43E-18 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 3.14E-31 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 4.30E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.62E-54 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.08E-08 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 8.40E-38 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 2.67E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 8.57E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 2.78E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.50E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 2.77E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.13E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.05E-19 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 3.46E-53 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.86E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 4.21E-122 mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 2.67E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.33E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 8.30E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 6.96E-19 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 3.50E-84 mr1711_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 4.36E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.67E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 2.63E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 7.68E-06 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 3.28E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 4.43E-84 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.09E-14 mr1986_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939815 NA 1.02E-54 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251