\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135939616:

Variant ID: vg0135939616 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35939616
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, A: 0.18, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCGAACACGGAGAGCTCGAGGATGGCCTCCGTCAGAGCACTGATGTGTTACGTCGTATGCTGTGGTTGACCGATGGCCCTGTCATCTGTGGGGTCCTA[T/A]
TGACAGCCTCTGAGTATGTTGTTTTTTATGTTACATATTTTTTTGTTTTGTTTACCAGTATAAGTAGCTCATTGCCTGCCAATCTTCTCTTTCCCTTCTG

Reverse complement sequence

CAGAAGGGAAAGAGAAGATTGGCAGGCAATGAGCTACTTATACTGGTAAACAAAACAAAAAAATATGTAACATAAAAAACAACATACTCAGAGGCTGTCA[A/T]
TAGGACCCCACAGATGACAGGGCCATCGGTCAACCACAGCATACGACGTAACACATCAGTGCTCTGACGGAGGCCATCCTCGAGCTCTCCGTGTTCGCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 34.20% 1.21% 0.00% NA
All Indica  2759 96.20% 2.40% 1.49% 0.00% NA
All Japonica  1512 2.10% 97.90% 0.00% 0.00% NA
Aus  269 91.80% 2.20% 5.95% 0.00% NA
Indica I  595 96.60% 1.80% 1.51% 0.00% NA
Indica II  465 97.40% 1.30% 1.29% 0.00% NA
Indica III  913 97.20% 0.90% 1.97% 0.00% NA
Indica Intermediate  786 93.90% 5.10% 1.02% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 47.80% 52.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135939616 T -> A LOC_Os01g62090.1 upstream_gene_variant ; 1085.0bp to feature; MODIFIER silent_mutation Average:15.628; most accessible tissue: Callus, score: 52.61 N N N N
vg0135939616 T -> A LOC_Os01g62100.1 upstream_gene_variant ; 624.0bp to feature; MODIFIER silent_mutation Average:15.628; most accessible tissue: Callus, score: 52.61 N N N N
vg0135939616 T -> A LOC_Os01g62090-LOC_Os01g62100 intergenic_region ; MODIFIER silent_mutation Average:15.628; most accessible tissue: Callus, score: 52.61 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135939616 NA 4.86E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 4.83E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 1.33E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 6.37E-06 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 8.19E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 5.98E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 3.66E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 5.86E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 5.53E-06 NA mr1901 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 1.88E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 8.90E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 4.56E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 5.96E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 3.44E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 2.08E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 2.34E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 4.80E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 5.28E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 6.65E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135939616 NA 8.75E-12 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251