Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135937532:

Variant ID: vg0135937532 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35937532
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

GCCCTATTTGTTCAGGCTTATAAGCCAACTTATAAGCCGAAAAGTCTAAGCCTAAACAAACAAGCAACTTATTTGTTTGGCTTTTTTTAAAGCCATAAGC[C/T]
ACTCTAACACTATTAAGCCAAAAGCTAGATTGGAGAAGCTTTTTTGGCTTATGTGAGGTTGATGTATGACTCCACCACTAAACTTAGGACATTAAATCTA

Reverse complement sequence

TAGATTTAATGTCCTAAGTTTAGTGGTGGAGTCATACATCAACCTCACATAAGCCAAAAAAGCTTCTCCAATCTAGCTTTTGGCTTAATAGTGTTAGAGT[G/A]
GCTTATGGCTTTAAAAAAAGCCAAACAAATAAGTTGCTTGTTTGTTTAGGCTTAGACTTTTCGGCTTATAAGTTGGCTTATAAGCCTGAACAAATAGGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.00%	40.60%	5.69%	9.67%	NA
All Indica	2759	69.20%	6.30%	8.77%	15.77%	NA
All Japonica	1512	1.10%	98.20%	0.46%	0.26%	NA
Aus	269	47.60%	42.80%	4.46%	5.20%	NA
Indica I	595	61.50%	10.80%	18.66%	9.08%	NA
Indica II	465	64.10%	1.10%	10.97%	23.87%	NA
Indica III	913	77.10%	3.00%	2.63%	17.31%	NA
Indica Intermediate	786	68.70%	9.90%	7.12%	14.25%	NA
Temperate Japonica	767	0.50%	99.00%	0.39%	0.13%	NA
Tropical Japonica	504	2.00%	97.20%	0.40%	0.40%	NA
Japonica Intermediate	241	0.80%	97.90%	0.83%	0.41%	NA
VI/Aromatic	96	5.20%	92.70%	1.04%	1.04%	NA
Intermediate	90	24.40%	64.40%	7.78%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135937532	C -> T	LOC_Os01g62100.1	upstream_gene_variant ; 2708.0bp to feature; MODIFIER	silent_mutation	Average:41.207; most accessible tissue: Callus, score: 67.589	N	N	N	N
vg0135937532	C -> T	LOC_Os01g62090.1	intron_variant ; MODIFIER	silent_mutation	Average:41.207; most accessible tissue: Callus, score: 67.589	N	N	N	N
vg0135937532	C -> DEL	N	N	silent_mutation	Average:41.207; most accessible tissue: Callus, score: 67.589	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135937532	NA	1.88E-06	mr1060	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	6.47E-16	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	1.29E-19	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	7.04E-06	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	1.58E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	2.65E-06	2.71E-07	mr1788	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	7.86E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	3.07E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	4.62E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	1.45E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	2.17E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	6.26E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	3.70E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	6.18E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135937532	NA	1.93E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251