Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135821566:

Variant ID: vg0135821566 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35821566
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATAACATGAATCTGAACATGCCCTAAGTCTACCATTTCCCTTTTTAAGAGAGATAAAATAAACTTTGGTATATTTGTATAGTACCTATGCATTTTTTT[A/T]
AAAAAAAACACCTAGTATTATACAATTGAAGCGAAGAATGAAAATGTTTTTTTTAAACTTAAGTTTTGTATTACCGTTTCCATTCTAAAATTAATATTAG

Reverse complement sequence

CTAATATTAATTTTAGAATGGAAACGGTAATACAAAACTTAAGTTTAAAAAAAACATTTTCATTCTTCGCTTCAATTGTATAATACTAGGTGTTTTTTTT[T/A]
AAAAAAATGCATAGGTACTATACAAATATACCAAAGTTTATTTTATCTCTCTTAAAAAGGGAAATGGTAGACTTAGGGCATGTTCAGATTCATGTTATAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	18.60%	6.09%	15.79%	NA
All Indica	2759	66.60%	1.40%	5.98%	25.95%	NA
All Japonica	1512	43.20%	48.10%	7.54%	1.19%	NA
Aus	269	97.80%	1.50%	0.74%	0.00%	NA
Indica I	595	65.40%	0.50%	12.27%	21.85%	NA
Indica II	465	26.70%	0.90%	2.15%	70.32%	NA
Indica III	913	89.70%	0.80%	4.71%	4.82%	NA
Indica Intermediate	786	64.40%	3.30%	4.96%	27.35%	NA
Temperate Japonica	767	61.70%	28.00%	9.52%	0.78%	NA
Tropical Japonica	504	14.90%	78.80%	4.76%	1.59%	NA
Japonica Intermediate	241	43.60%	47.70%	7.05%	1.66%	NA
VI/Aromatic	96	13.50%	83.30%	1.04%	2.08%	NA
Intermediate	90	53.30%	28.90%	6.67%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135821566	A -> T	LOC_Os01g61890.1	upstream_gene_variant ; 706.0bp to feature; MODIFIER	silent_mutation	Average:44.062; most accessible tissue: Callus, score: 82.09	N	N	N	N
vg0135821566	A -> T	LOC_Os01g61890.2	upstream_gene_variant ; 698.0bp to feature; MODIFIER	silent_mutation	Average:44.062; most accessible tissue: Callus, score: 82.09	N	N	N	N
vg0135821566	A -> T	LOC_Os01g61890.3	upstream_gene_variant ; 698.0bp to feature; MODIFIER	silent_mutation	Average:44.062; most accessible tissue: Callus, score: 82.09	N	N	N	N
vg0135821566	A -> T	LOC_Os01g61890.4	upstream_gene_variant ; 698.0bp to feature; MODIFIER	silent_mutation	Average:44.062; most accessible tissue: Callus, score: 82.09	N	N	N	N
vg0135821566	A -> T	LOC_Os01g61880.1	downstream_gene_variant ; 3882.0bp to feature; MODIFIER	silent_mutation	Average:44.062; most accessible tissue: Callus, score: 82.09	N	N	N	N
vg0135821566	A -> T	LOC_Os01g61880.2	downstream_gene_variant ; 3882.0bp to feature; MODIFIER	silent_mutation	Average:44.062; most accessible tissue: Callus, score: 82.09	N	N	N	N
vg0135821566	A -> T	LOC_Os01g61890-LOC_Os01g61900	intergenic_region ; MODIFIER	silent_mutation	Average:44.062; most accessible tissue: Callus, score: 82.09	N	N	N	N
vg0135821566	A -> DEL	N	N	silent_mutation	Average:44.062; most accessible tissue: Callus, score: 82.09	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135821566	NA	5.87E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135821566	2.58E-06	NA	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135821566	NA	5.07E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135821566	NA	3.02E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	2.86E-17	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	1.30E-06	mr1070	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	2.20E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	6.45E-14	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	5.58E-06	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	3.61E-16	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	3.18E-06	3.17E-06	mr1128	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	3.05E-07	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	6.91E-07	mr1154	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	4.26E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	1.41E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	2.38E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	8.34E-06	mr1773	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	6.70E-08	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	6.70E-08	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	1.03E-06	mr1802	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	1.04E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	2.57E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	6.20E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	6.89E-07	NA	mr1092_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	6.17E-08	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	2.37E-14	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	1.36E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	2.93E-07	2.80E-20	mr1128_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	2.92E-08	mr1128_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	9.89E-08	NA	mr1152_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	1.19E-08	mr1152_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	5.81E-07	NA	mr1154_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	3.98E-09	mr1154_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	2.60E-08	NA	mr1164_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	9.61E-11	mr1164_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	6.56E-09	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	6.52E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	1.26E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566	NA	3.96E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251