\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135821566:

Variant ID: vg0135821566 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35821566
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATAACATGAATCTGAACATGCCCTAAGTCTACCATTTCCCTTTTTAAGAGAGATAAAATAAACTTTGGTATATTTGTATAGTACCTATGCATTTTTTT[A/T]
AAAAAAAACACCTAGTATTATACAATTGAAGCGAAGAATGAAAATGTTTTTTTTAAACTTAAGTTTTGTATTACCGTTTCCATTCTAAAATTAATATTAG

Reverse complement sequence

CTAATATTAATTTTAGAATGGAAACGGTAATACAAAACTTAAGTTTAAAAAAAACATTTTCATTCTTCGCTTCAATTGTATAATACTAGGTGTTTTTTTT[T/A]
AAAAAAATGCATAGGTACTATACAAATATACCAAAGTTTATTTTATCTCTCTTAAAAAGGGAAATGGTAGACTTAGGGCATGTTCAGATTCATGTTATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 18.60% 6.09% 15.79% NA
All Indica  2759 66.60% 1.40% 5.98% 25.95% NA
All Japonica  1512 43.20% 48.10% 7.54% 1.19% NA
Aus  269 97.80% 1.50% 0.74% 0.00% NA
Indica I  595 65.40% 0.50% 12.27% 21.85% NA
Indica II  465 26.70% 0.90% 2.15% 70.32% NA
Indica III  913 89.70% 0.80% 4.71% 4.82% NA
Indica Intermediate  786 64.40% 3.30% 4.96% 27.35% NA
Temperate Japonica  767 61.70% 28.00% 9.52% 0.78% NA
Tropical Japonica  504 14.90% 78.80% 4.76% 1.59% NA
Japonica Intermediate  241 43.60% 47.70% 7.05% 1.66% NA
VI/Aromatic  96 13.50% 83.30% 1.04% 2.08% NA
Intermediate  90 53.30% 28.90% 6.67% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135821566 A -> T LOC_Os01g61890.1 upstream_gene_variant ; 706.0bp to feature; MODIFIER silent_mutation Average:44.062; most accessible tissue: Callus, score: 82.09 N N N N
vg0135821566 A -> T LOC_Os01g61890.2 upstream_gene_variant ; 698.0bp to feature; MODIFIER silent_mutation Average:44.062; most accessible tissue: Callus, score: 82.09 N N N N
vg0135821566 A -> T LOC_Os01g61890.3 upstream_gene_variant ; 698.0bp to feature; MODIFIER silent_mutation Average:44.062; most accessible tissue: Callus, score: 82.09 N N N N
vg0135821566 A -> T LOC_Os01g61890.4 upstream_gene_variant ; 698.0bp to feature; MODIFIER silent_mutation Average:44.062; most accessible tissue: Callus, score: 82.09 N N N N
vg0135821566 A -> T LOC_Os01g61880.1 downstream_gene_variant ; 3882.0bp to feature; MODIFIER silent_mutation Average:44.062; most accessible tissue: Callus, score: 82.09 N N N N
vg0135821566 A -> T LOC_Os01g61880.2 downstream_gene_variant ; 3882.0bp to feature; MODIFIER silent_mutation Average:44.062; most accessible tissue: Callus, score: 82.09 N N N N
vg0135821566 A -> T LOC_Os01g61890-LOC_Os01g61900 intergenic_region ; MODIFIER silent_mutation Average:44.062; most accessible tissue: Callus, score: 82.09 N N N N
vg0135821566 A -> DEL N N silent_mutation Average:44.062; most accessible tissue: Callus, score: 82.09 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135821566 NA 5.87E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135821566 2.58E-06 NA Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135821566 NA 5.07E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135821566 NA 3.02E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 2.86E-17 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 1.30E-06 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 2.20E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 6.45E-14 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 5.58E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 3.61E-16 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 3.18E-06 3.17E-06 mr1128 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 3.05E-07 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 6.91E-07 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 4.26E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 1.41E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 2.38E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 8.34E-06 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 6.70E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 6.70E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 1.03E-06 mr1802 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 1.04E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 2.57E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 6.20E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 6.89E-07 NA mr1092_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 6.17E-08 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 2.37E-14 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 1.36E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 2.93E-07 2.80E-20 mr1128_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 2.92E-08 mr1128_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 9.89E-08 NA mr1152_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 1.19E-08 mr1152_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 5.81E-07 NA mr1154_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 3.98E-09 mr1154_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 2.60E-08 NA mr1164_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 9.61E-11 mr1164_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 6.56E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 6.52E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 1.26E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135821566 NA 3.96E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251