\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135810780:

Variant ID: vg0135810780 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35810780
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTTTCAATAATTCTTTTTTAGTACAAATTTTAGTTATTTATATAATGTATTCCACTCTCATTTTTATTTTTGTATTTTCGTGTTTTTTTATTTTGAAT[G/T]
TCAATTACTCTCATGTCGTGTTCTTATTTGGAGATAAATTATATTCCTATATGAACTCTTATAAATATTTTTCTATTTTCAGAATTTATTTTATTTGTTA

Reverse complement sequence

TAACAAATAAAATAAATTCTGAAAATAGAAAAATATTTATAAGAGTTCATATAGGAATATAATTTATCTCCAAATAAGAACACGACATGAGAGTAATTGA[C/A]
ATTCAAAATAAAAAAACACGAAAATACAAAAATAAAAATGAGAGTGGAATACATTATATAAATAACTAAAATTTGTACTAAAAAAGAATTATTGAAAGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 35.00% 1.38% 0.49% NA
All Indica  2759 96.30% 1.10% 1.85% 0.72% NA
All Japonica  1512 1.80% 98.10% 0.07% 0.07% NA
Aus  269 95.50% 0.70% 3.35% 0.37% NA
Indica I  595 98.00% 0.30% 1.51% 0.17% NA
Indica II  465 91.60% 0.40% 5.81% 2.15% NA
Indica III  913 99.20% 0.40% 0.11% 0.22% NA
Indica Intermediate  786 94.40% 2.90% 1.78% 0.89% NA
Temperate Japonica  767 1.30% 98.60% 0.13% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 8.30% 88.50% 3.12% 0.00% NA
Intermediate  90 41.10% 56.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135810780 G -> T LOC_Os01g61880.1 upstream_gene_variant ; 2368.0bp to feature; MODIFIER silent_mutation Average:25.051; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0135810780 G -> T LOC_Os01g61880.2 upstream_gene_variant ; 3327.0bp to feature; MODIFIER silent_mutation Average:25.051; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0135810780 G -> T LOC_Os01g61870.1 downstream_gene_variant ; 2492.0bp to feature; MODIFIER silent_mutation Average:25.051; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0135810780 G -> T LOC_Os01g61890.2 downstream_gene_variant ; 3299.0bp to feature; MODIFIER silent_mutation Average:25.051; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0135810780 G -> T LOC_Os01g61890.3 downstream_gene_variant ; 3299.0bp to feature; MODIFIER silent_mutation Average:25.051; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0135810780 G -> T LOC_Os01g61870-LOC_Os01g61880 intergenic_region ; MODIFIER silent_mutation Average:25.051; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0135810780 G -> DEL N N silent_mutation Average:25.051; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135810780 NA 3.78E-108 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 1.95E-106 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 2.47E-27 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 4.10E-07 1.36E-95 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 9.19E-08 1.06E-90 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 2.84E-43 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 7.93E-31 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 6.58E-28 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 8.24E-06 8.25E-101 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 2.26E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 4.92E-100 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 2.94E-76 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 4.06E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 2.69E-31 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 3.63E-38 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 3.84E-93 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 3.47E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 5.03E-112 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 4.55E-26 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 5.34E-82 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 1.14E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 2.29E-33 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 5.85E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 2.51E-06 4.16E-107 mr1134_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 2.65E-06 1.04E-09 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 2.01E-49 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 2.72E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 6.95E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 1.36E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 1.56E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 2.54E-34 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 9.66E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 7.57E-07 5.37E-97 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 8.41E-07 3.35E-09 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 1.67E-145 mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 1.25E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 7.93E-111 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 3.00E-37 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 5.43E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 2.52E-09 4.61E-56 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 3.84E-06 3.84E-06 mr1670_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 7.59E-06 2.25E-129 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 5.99E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135810780 NA 6.26E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251