Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135705062:

Variant ID: vg0135705062 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35705062
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCATATTTCAACAGATTTTACCAACTTATATAAAGATGAAAAATAAAGCTATGCAGTTACTGGTTCACTACGCCTTCAACATTAATTTTTAGCATATA[T/C]
TTCCTATGTGTTCGTAGATACAGTTTGCAACATTTAAGATCTAAGGTTCCATGTGATACTGAGATGTAACTACACTGAACCAGATAACTACATGCTCTAT

Reverse complement sequence

ATAGAGCATGTAGTTATCTGGTTCAGTGTAGTTACATCTCAGTATCACATGGAACCTTAGATCTTAAATGTTGCAAACTGTATCTACGAACACATAGGAA[A/G]
TATATGCTAAAAATTAATGTTGAAGGCGTAGTGAACCAGTAACTGCATAGCTTTATTTTTCATCTTTATATAAGTTGGTAAAATCTGTTGAAATATGCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.70%	34.10%	0.17%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.00%	0.00%	NA
All Japonica	1512	3.50%	96.00%	0.53%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.20%	2.80%	0.00%	0.00%	NA
Temperate Japonica	767	1.30%	98.60%	0.13%	0.00%	NA
Tropical Japonica	504	7.10%	91.70%	1.19%	0.00%	NA
Japonica Intermediate	241	2.90%	96.70%	0.41%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	46.70%	53.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135705062	T -> C	LOC_Os01g61720.1	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61720.7	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61720.4	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61720.6	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61720.10	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61720.9	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61720.2	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61720.8	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61720.3	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61710.1	intron_variant ; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61710.3	intron_variant ; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61710.2	intron_variant ; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61710.6	intron_variant ; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61710.4	intron_variant ; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N
vg0135705062	T -> C	LOC_Os01g61710.5	intron_variant ; MODIFIER	silent_mutation	Average:55.531; most accessible tissue: Callus, score: 83.356	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135705062	NA	5.20E-109	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	1.95E-106	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	2.46E-25	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	1.26E-26	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	1.07E-31	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	1.43E-28	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	5.88E-44	mr1092	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	2.53E-89	mr1134	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	3.42E-87	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	4.24E-45	mr1152	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	3.67E-29	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	9.76E-31	mr1256	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	4.09E-27	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	6.48E-96	mr1504	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	4.57E-09	3.17E-105	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	5.17E-08	4.32E-79	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	4.40E-06	1.25E-07	mr1538	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	9.07E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	5.96E-46	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	8.89E-26	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	7.02E-39	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	2.59E-32	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	9.61E-36	mr1670	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	8.66E-93	mr1672	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	1.74E-35	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	3.39E-89	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	9.13E-54	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	2.09E-72	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	1.68E-12	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	5.63E-111	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	2.75E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	2.83E-80	mr1027_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	2.38E-27	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	7.31E-33	mr1081_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	2.30E-98	mr1134_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	5.50E-34	mr1256_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	8.38E-92	mr1504_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	2.32E-09	1.40E-151	mr1517_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	1.67E-09	1.13E-117	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	3.85E-06	3.62E-08	mr1538_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	1.18E-38	mr1541_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	1.32E-81	mr1563_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	9.84E-51	mr1670_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135705062	NA	2.26E-125	mr1672_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251