\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135645855:

Variant ID: vg0135645855 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35645855
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


AATGAATCATATAAGAAATCTGTTTAAAAAAACTCGCATGCTAACTTGAGACGATCGGACTCCTAACTGTAGCCCATGATTTTCTAAAAATATATATATC[T/C]
AATCGAACTCCCATAGTGAATTTCATCATAACTAAACCATATAACAATAGTAAGATTAAAATAGACTTCACCCATTGCAACGCACGGATATTTTTTCTAG

Reverse complement sequence

CTAGAAAAAATATCCGTGCGTTGCAATGGGTGAAGTCTATTTTAATCTTACTATTGTTATATGGTTTAGTTATGATGAAATTCACTATGGGAGTTCGATT[A/G]
GATATATATATTTTTAGAAAATCATGGGCTACAGTTAGGAGTCCGATCGTCTCAAGTTAGCATGCGAGTTTTTTTAAACAGATTTCTTATATGATTCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 8.50% 3.77% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 62.40% 26.10% 11.57% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 41.20% 40.40% 18.38% 0.00% NA
Tropical Japonica  504 91.70% 5.40% 2.98% 0.00% NA
Japonica Intermediate  241 68.50% 23.70% 7.88% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 3.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135645855 T -> C LOC_Os01g61610.1 downstream_gene_variant ; 4619.0bp to feature; MODIFIER silent_mutation Average:38.931; most accessible tissue: Minghui63 root, score: 73.351 N N N N
vg0135645855 T -> C LOC_Os01g61610.2 downstream_gene_variant ; 4619.0bp to feature; MODIFIER silent_mutation Average:38.931; most accessible tissue: Minghui63 root, score: 73.351 N N N N
vg0135645855 T -> C LOC_Os01g61610.3 downstream_gene_variant ; 4619.0bp to feature; MODIFIER silent_mutation Average:38.931; most accessible tissue: Minghui63 root, score: 73.351 N N N N
vg0135645855 T -> C LOC_Os01g61610-LOC_Os01g61620 intergenic_region ; MODIFIER silent_mutation Average:38.931; most accessible tissue: Minghui63 root, score: 73.351 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135645855 3.77E-06 NA mr1097 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855 NA 2.31E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855 1.67E-06 1.67E-06 mr1128 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855 NA 1.18E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855 7.11E-06 7.11E-06 mr1249 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855 NA 1.71E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855 1.26E-06 1.26E-06 mr1935 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855 NA 4.92E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251