\
| Variant ID: vg0135645855 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 35645855 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )
AATGAATCATATAAGAAATCTGTTTAAAAAAACTCGCATGCTAACTTGAGACGATCGGACTCCTAACTGTAGCCCATGATTTTCTAAAAATATATATATC[T/C]
AATCGAACTCCCATAGTGAATTTCATCATAACTAAACCATATAACAATAGTAAGATTAAAATAGACTTCACCCATTGCAACGCACGGATATTTTTTCTAG
CTAGAAAAAATATCCGTGCGTTGCAATGGGTGAAGTCTATTTTAATCTTACTATTGTTATATGGTTTAGTTATGATGAAATTCACTATGGGAGTTCGATT[A/G]
GATATATATATTTTTAGAAAATCATGGGCTACAGTTAGGAGTCCGATCGTCTCAAGTTAGCATGCGAGTTTTTTTAAACAGATTTCTTATATGATTCATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 8.50% | 3.77% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 62.40% | 26.10% | 11.57% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 41.20% | 40.40% | 18.38% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 5.40% | 2.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.50% | 23.70% | 7.88% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0135645855 | T -> C | LOC_Os01g61610.1 | downstream_gene_variant ; 4619.0bp to feature; MODIFIER | silent_mutation | Average:38.931; most accessible tissue: Minghui63 root, score: 73.351 | N | N | N | N |
| vg0135645855 | T -> C | LOC_Os01g61610.2 | downstream_gene_variant ; 4619.0bp to feature; MODIFIER | silent_mutation | Average:38.931; most accessible tissue: Minghui63 root, score: 73.351 | N | N | N | N |
| vg0135645855 | T -> C | LOC_Os01g61610.3 | downstream_gene_variant ; 4619.0bp to feature; MODIFIER | silent_mutation | Average:38.931; most accessible tissue: Minghui63 root, score: 73.351 | N | N | N | N |
| vg0135645855 | T -> C | LOC_Os01g61610-LOC_Os01g61620 | intergenic_region ; MODIFIER | silent_mutation | Average:38.931; most accessible tissue: Minghui63 root, score: 73.351 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0135645855 | 3.77E-06 | NA | mr1097 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135645855 | NA | 2.31E-07 | mr1097 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135645855 | 1.67E-06 | 1.67E-06 | mr1128 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135645855 | NA | 1.18E-06 | mr1154 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135645855 | 7.11E-06 | 7.11E-06 | mr1249 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135645855 | NA | 1.71E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135645855 | 1.26E-06 | 1.26E-06 | mr1935 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135645855 | NA | 4.92E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |