Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135645855:

Variant ID: vg0135645855 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35645855
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

AATGAATCATATAAGAAATCTGTTTAAAAAAACTCGCATGCTAACTTGAGACGATCGGACTCCTAACTGTAGCCCATGATTTTCTAAAAATATATATATC[T/C]
AATCGAACTCCCATAGTGAATTTCATCATAACTAAACCATATAACAATAGTAAGATTAAAATAGACTTCACCCATTGCAACGCACGGATATTTTTTCTAG

Reverse complement sequence

CTAGAAAAAATATCCGTGCGTTGCAATGGGTGAAGTCTATTTTAATCTTACTATTGTTATATGGTTTAGTTATGATGAAATTCACTATGGGAGTTCGATT[A/G]
GATATATATATTTTTAGAAAATCATGGGCTACAGTTAGGAGTCCGATCGTCTCAAGTTAGCATGCGAGTTTTTTTAAACAGATTTCTTATATGATTCATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.80%	8.50%	3.77%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	62.40%	26.10%	11.57%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	41.20%	40.40%	18.38%	0.00%	NA
Tropical Japonica	504	91.70%	5.40%	2.98%	0.00%	NA
Japonica Intermediate	241	68.50%	23.70%	7.88%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	3.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135645855	T -> C	LOC_Os01g61610.1	downstream_gene_variant ; 4619.0bp to feature; MODIFIER	silent_mutation	Average:38.931; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N
vg0135645855	T -> C	LOC_Os01g61610.2	downstream_gene_variant ; 4619.0bp to feature; MODIFIER	silent_mutation	Average:38.931; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N
vg0135645855	T -> C	LOC_Os01g61610.3	downstream_gene_variant ; 4619.0bp to feature; MODIFIER	silent_mutation	Average:38.931; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N
vg0135645855	T -> C	LOC_Os01g61610-LOC_Os01g61620	intergenic_region ; MODIFIER	silent_mutation	Average:38.931; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135645855	3.77E-06	NA	mr1097	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855	NA	2.31E-07	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855	1.67E-06	1.67E-06	mr1128	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855	NA	1.18E-06	mr1154	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855	7.11E-06	7.11E-06	mr1249	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855	NA	1.71E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855	1.26E-06	1.26E-06	mr1935	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135645855	NA	4.92E-06	mr1576_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251