\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135593600:

Variant ID: vg0135593600 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35593600
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAAACTTTTAGCGGAAATAAAAGTTACCCTCAAAATCGACGGAGATCGGTCTGACCGAAGTTGCCTTGCCAGTCTGACCGCTCGGATGTCGTCGGTCT[G/A]
ACCGGTATAGATCAACCGGTCTGACCGCTGAAGCTGCTTGCCGCGCCTGTCGTCACCTCCGGTCTGACCGCCGTGCACCCGCCGGTCTGACCGCCGCTTG

Reverse complement sequence

CAAGCGGCGGTCAGACCGGCGGGTGCACGGCGGTCAGACCGGAGGTGACGACAGGCGCGGCAAGCAGCTTCAGCGGTCAGACCGGTTGATCTATACCGGT[C/T]
AGACCGACGACATCCGAGCGGTCAGACTGGCAAGGCAACTTCGGTCAGACCGATCTCCGTCGATTTTGAGGGTAACTTTTATTTCCGCTAAAAGTTTTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 10.60% 33.58% 2.67% NA
All Indica  2759 27.10% 17.20% 51.25% 4.42% NA
All Japonica  1512 98.60% 0.30% 0.93% 0.13% NA
Aus  269 43.90% 6.30% 49.44% 0.37% NA
Indica I  595 41.80% 7.90% 42.52% 7.73% NA
Indica II  465 23.20% 17.80% 50.75% 8.17% NA
Indica III  913 18.80% 25.20% 53.56% 2.41% NA
Indica Intermediate  786 28.00% 14.50% 55.47% 2.04% NA
Temperate Japonica  767 99.00% 0.10% 0.91% 0.00% NA
Tropical Japonica  504 98.40% 0.60% 0.60% 0.40% NA
Japonica Intermediate  241 97.90% 0.40% 1.66% 0.00% NA
VI/Aromatic  96 94.80% 1.00% 4.17% 0.00% NA
Intermediate  90 70.00% 4.40% 24.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135593600 G -> A LOC_Os01g61520.1 upstream_gene_variant ; 2433.0bp to feature; MODIFIER silent_mutation Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0135593600 G -> A LOC_Os01g61540.1 upstream_gene_variant ; 1342.0bp to feature; MODIFIER silent_mutation Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0135593600 G -> A LOC_Os01g61530.1 downstream_gene_variant ; 142.0bp to feature; MODIFIER silent_mutation Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0135593600 G -> A LOC_Os01g61550.1 downstream_gene_variant ; 3492.0bp to feature; MODIFIER silent_mutation Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0135593600 G -> A LOC_Os01g61530-LOC_Os01g61540 intergenic_region ; MODIFIER silent_mutation Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0135593600 G -> DEL N N silent_mutation Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135593600 2.19E-07 NA mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135593600 2.96E-07 9.65E-10 mr1517 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135593600 NA 5.74E-06 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135593600 NA 2.67E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135593600 NA 2.75E-07 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251