\
| Variant ID: vg0135571255 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 35571255 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 103. )
TGGGCTTGAAAGATCTGAAGTTTGAGAAAGATAAGCTTTGTAGTGCTTGTCAAGCCGGCAAGCAAGTTGCAGGTTCTCATTCTACTAAGAGTATCATGTC[C/T]
ACATCTAGACCATTGGAGCTCTTGCATATGAATTTGTTTGGCCCAACAACCTATAAGAGCATTGGTGGTAATAGTCATTGTCTTGTGATTGTTGATGATT
AATCATCAACAATCACAAGACAATGACTATTACCACCAATGCTCTTATAGGTTGTTGGGCCAAACAAATTCATATGCAAGAGCTCCAATGGTCTAGATGT[G/A]
GACATGATACTCTTAGTAGAATGAGAACCTGCAACTTGCTTGCCGGCTTGACAAGCACTACAAAGCTTATCTTTCTCAAACTTCAGATCTTTCAAGCCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.60% | 10.50% | 42.04% | 8.89% | NA |
| All Indica | 2759 | 5.40% | 17.10% | 63.39% | 14.10% | NA |
| All Japonica | 1512 | 98.30% | 0.20% | 1.06% | 0.46% | NA |
| Aus | 269 | 16.00% | 6.30% | 72.49% | 5.20% | NA |
| Indica I | 595 | 4.70% | 22.70% | 54.12% | 18.49% | NA |
| Indica II | 465 | 2.20% | 12.70% | 67.10% | 18.06% | NA |
| Indica III | 913 | 7.20% | 16.10% | 68.78% | 7.89% | NA |
| Indica Intermediate | 786 | 5.70% | 16.70% | 61.96% | 15.65% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.91% | 0.26% | NA |
| Tropical Japonica | 504 | 97.60% | 0.60% | 1.19% | 0.60% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 1.24% | 0.83% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 6.25% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 4.40% | 23.33% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0135571255 | C -> T | LOC_Os01g61490.1 | synonymous_variant ; p.Ser778Ser; LOW | synonymous_codon | Average:9.006; most accessible tissue: Callus, score: 28.266 | N | N | N | N |
| vg0135571255 | C -> DEL | LOC_Os01g61490.1 | N | frameshift_variant | Average:9.006; most accessible tissue: Callus, score: 28.266 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0135571255 | NA | 1.95E-22 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135571255 | NA | 2.97E-21 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135571255 | NA | 1.52E-24 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135571255 | NA | 3.32E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135571255 | NA | 2.05E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135571255 | NA | 1.23E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135571255 | 5.22E-06 | 2.65E-37 | mr1571_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135571255 | NA | 1.66E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135571255 | NA | 2.22E-12 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135571255 | NA | 2.54E-20 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |