\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135554286:

Variant ID: vg0135554286 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35554286
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAATTTGCAATGAGCAGATTTTTTTTTAAAAAATACTAACCGGTTTTCAGGCAAATCGACTAAGAAACTACTACTACTCTAGACATGAAGGAAAAAAAT[A/T]
AAAAAGATAGGTATTTCTAGTCGCCCCTAACCCGAAATATACATAGGGGCACCTAGGATCAGTGGCCTGGTATTAAATATATTTTAGAATAGATTTTGAG

Reverse complement sequence

CTCAAAATCTATTCTAAAATATATTTAATACCAGGCCACTGATCCTAGGTGCCCCTATGTATATTTCGGGTTAGGGGCGACTAGAAATACCTATCTTTTT[T/A]
ATTTTTTTCCTTCATGTCTAGAGTAGTAGTAGTTTCTTAGTCGATTTGCCTGAAAACCGGTTAGTATTTTTTAAAAAAAAATCTGCTCATTGCAAATTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 4.90% 0.06% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 85.30% 14.60% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 57.70% 41.70% 0.60% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135554286 A -> T LOC_Os01g61480.1 upstream_gene_variant ; 3862.0bp to feature; MODIFIER silent_mutation Average:41.284; most accessible tissue: Callus, score: 79.707 N N N N
vg0135554286 A -> T LOC_Os01g61470-LOC_Os01g61480 intergenic_region ; MODIFIER silent_mutation Average:41.284; most accessible tissue: Callus, score: 79.707 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135554286 NA 1.19E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135554286 4.59E-06 1.32E-09 mr1090_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135554286 NA 3.03E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135554286 2.58E-06 2.58E-06 mr1111_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135554286 NA 1.27E-08 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135554286 NA 1.20E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135554286 NA 8.82E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135554286 NA 1.39E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135554286 NA 9.87E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251