\
| Variant ID: vg0135554286 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 35554286 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTAATTTGCAATGAGCAGATTTTTTTTTAAAAAATACTAACCGGTTTTCAGGCAAATCGACTAAGAAACTACTACTACTCTAGACATGAAGGAAAAAAAT[A/T]
AAAAAGATAGGTATTTCTAGTCGCCCCTAACCCGAAATATACATAGGGGCACCTAGGATCAGTGGCCTGGTATTAAATATATTTTAGAATAGATTTTGAG
CTCAAAATCTATTCTAAAATATATTTAATACCAGGCCACTGATCCTAGGTGCCCCTATGTATATTTCGGGTTAGGGGCGACTAGAAATACCTATCTTTTT[T/A]
ATTTTTTTCCTTCATGTCTAGAGTAGTAGTAGTTTCTTAGTCGATTTGCCTGAAAACCGGTTAGTATTTTTTAAAAAAAAATCTGCTCATTGCAAATTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 4.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 85.30% | 14.60% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 57.70% | 41.70% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0135554286 | A -> T | LOC_Os01g61480.1 | upstream_gene_variant ; 3862.0bp to feature; MODIFIER | silent_mutation | Average:41.284; most accessible tissue: Callus, score: 79.707 | N | N | N | N |
| vg0135554286 | A -> T | LOC_Os01g61470-LOC_Os01g61480 | intergenic_region ; MODIFIER | silent_mutation | Average:41.284; most accessible tissue: Callus, score: 79.707 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0135554286 | NA | 1.19E-06 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135554286 | 4.59E-06 | 1.32E-09 | mr1090_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135554286 | NA | 3.03E-07 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135554286 | 2.58E-06 | 2.58E-06 | mr1111_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135554286 | NA | 1.27E-08 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135554286 | NA | 1.20E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135554286 | NA | 8.82E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135554286 | NA | 1.39E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135554286 | NA | 9.87E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |