\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135430076:

Variant ID: vg0135430076 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35430076
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCAGCGCTGTCCATCTCAACGACGAATGGAAACGATGGATTCATATGGACGCGGCTACGGTCGGTCGCCCGATCCGGGGCCGGGAAAATCGTTTACGTG[C/T]
AAAACTATTTTAAACTGATTTTTCTCTTAAATTACTCATTCAAATCATGATCCGATTGCACTATTAAATTTGTTGCAATTAAATCTTCAAAACAAGACCA

Reverse complement sequence

TGGTCTTGTTTTGAAGATTTAATTGCAACAAATTTAATAGTGCAATCGGATCATGATTTGAATGAGTAATTTAAGAGAAAAATCAGTTTAAAATAGTTTT[G/A]
CACGTAAACGATTTTCCCGGCCCCGGATCGGGCGACCGACCGTAGCCGCGTCCATATGAATCCATCGTTTCCATTCGTCGTTGAGATGGACAGCGCTGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 7.10% 0.00% 0.00% NA
All Indica  2759 93.50% 6.50% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 46.50% 53.50% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 88.40% 11.60% 0.00% 0.00% NA
Indica Intermediate  786 93.60% 6.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135430076 C -> T LOC_Os01g61220.1 upstream_gene_variant ; 2039.0bp to feature; MODIFIER silent_mutation Average:63.759; most accessible tissue: Callus, score: 82.245 N N N N
vg0135430076 C -> T LOC_Os01g61230.1 upstream_gene_variant ; 780.0bp to feature; MODIFIER silent_mutation Average:63.759; most accessible tissue: Callus, score: 82.245 N N N N
vg0135430076 C -> T LOC_Os01g61240.1 upstream_gene_variant ; 3825.0bp to feature; MODIFIER silent_mutation Average:63.759; most accessible tissue: Callus, score: 82.245 N N N N
vg0135430076 C -> T LOC_Os01g61220-LOC_Os01g61230 intergenic_region ; MODIFIER silent_mutation Average:63.759; most accessible tissue: Callus, score: 82.245 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135430076 NA 3.75E-06 mr1297 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135430076 6.65E-06 6.63E-06 mr1421 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135430076 NA 9.72E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251