\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135405957:

Variant ID: vg0135405957 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35405957
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GCACAAATAAGCAGAGCGGTGAGGCGGCCAGCCGAGGAGACGAGTAGTGGCTGGGTATTTATTGAAGTAGAGAAAAGATGAAGCCCTAGCCTTTTTTTTT[G/T]
AACGGAAGTGCGTGAACTAGTTTGTGAACTAGTTTGGGCTGTGTGACCTGCTTCTGGGCGCTTCCGGCGGGCGACGGATGGCTACCAATTCCAGCCAATG

Reverse complement sequence

CATTGGCTGGAATTGGTAGCCATCCGTCGCCCGCCGGAAGCGCCCAGAAGCAGGTCACACAGCCCAAACTAGTTCACAAACTAGTTCACGCACTTCCGTT[C/A]
AAAAAAAAAGGCTAGGGCTTCATCTTTTCTCTACTTCAATAAATACCCAGCCACTACTCGTCTCCTCGGCTGGCCGCCTCACCGCTCTGCTTATTTGTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 44.60% 0.17% 0.00% NA
All Indica  2759 90.10% 9.80% 0.07% 0.00% NA
All Japonica  1512 3.50% 96.20% 0.33% 0.00% NA
Aus  269 12.30% 87.70% 0.00% 0.00% NA
Indica I  595 92.80% 7.20% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 86.20% 13.80% 0.00% 0.00% NA
Indica Intermediate  786 87.50% 12.20% 0.25% 0.00% NA
Temperate Japonica  767 1.70% 97.80% 0.52% 0.00% NA
Tropical Japonica  504 5.60% 94.20% 0.20% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 38.90% 60.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135405957 G -> T LOC_Os01g61180.1 upstream_gene_variant ; 3333.0bp to feature; MODIFIER silent_mutation Average:79.528; most accessible tissue: Callus, score: 93.885 N N N N
vg0135405957 G -> T LOC_Os01g61160.1 downstream_gene_variant ; 648.0bp to feature; MODIFIER silent_mutation Average:79.528; most accessible tissue: Callus, score: 93.885 N N N N
vg0135405957 G -> T LOC_Os01g61170.1 downstream_gene_variant ; 1973.0bp to feature; MODIFIER silent_mutation Average:79.528; most accessible tissue: Callus, score: 93.885 N N N N
vg0135405957 G -> T LOC_Os01g61160-LOC_Os01g61170 intergenic_region ; MODIFIER silent_mutation Average:79.528; most accessible tissue: Callus, score: 93.885 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0135405957 G T 0.03 0.0 0.0 0.01 0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135405957 NA 1.53E-22 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 3.14E-08 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 1.77E-11 7.03E-15 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 2.14E-08 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 7.94E-13 1.17E-15 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 7.43E-06 5.07E-07 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 4.13E-06 6.36E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 2.64E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 2.59E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 1.72E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 1.02E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 3.90E-06 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 5.04E-10 4.99E-14 mr1008_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 6.70E-07 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 2.84E-20 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 1.72E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 6.52E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 5.40E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 1.79E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135405957 NA 2.51E-12 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251