Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135297102:

Variant ID: vg0135297102 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35297102
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CAGGCCGGGCCCGCTTACATCTAATAGCTTTCATAGGTCATAGACTGTCCCATGGCGTGAATTAATATACCACTTAGTCATTAACCCATTGTAACGTCTC[G/A]
CCTCTTCCCAGGCCGGGCCCGCTTACATCTGATAGTTTTCATAGGTCATAGACTGTCCCTCTGTGAACTCGTGCGTACCCGGGAAGAATTCTTTGCAGAT

Reverse complement sequence

ATCTGCAAAGAATTCTTCCCGGGTACGCACGAGTTCACAGAGGGACAGTCTATGACCTATGAAAACTATCAGATGTAAGCGGGCCCGGCCTGGGAAGAGG[C/T]
GAGACGTTACAATGGGTTAATGACTAAGTGGTATATTAATTCACGCCATGGGACAGTCTATGACCTATGAAAGCTATTAGATGTAAGCGGGCCCGGCCTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.50%	1.50%	0.34%	51.67%	NA
All Indica	2759	11.40%	2.50%	0.51%	85.54%	NA
All Japonica	1512	98.30%	0.00%	0.07%	1.65%	NA
Aus	269	90.30%	0.40%	0.00%	9.29%	NA
Indica I	595	7.60%	3.70%	0.50%	88.24%	NA
Indica II	465	2.20%	2.40%	0.43%	95.05%	NA
Indica III	913	15.20%	1.50%	0.22%	83.02%	NA
Indica Intermediate	786	15.40%	2.90%	0.89%	80.79%	NA
Temperate Japonica	767	98.80%	0.00%	0.00%	1.17%	NA
Tropical Japonica	504	97.40%	0.00%	0.20%	2.38%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	65.60%	0.00%	1.11%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135297102	G -> A	LOC_Os01g61000.1	upstream_gene_variant ; 2339.0bp to feature; MODIFIER	silent_mutation	Average:62.035; most accessible tissue: Zhenshan97 flag leaf, score: 85.388	N	N	N	N
vg0135297102	G -> A	LOC_Os01g61000-LOC_Os01g61010	intergenic_region ; MODIFIER	silent_mutation	Average:62.035; most accessible tissue: Zhenshan97 flag leaf, score: 85.388	N	N	N	N
vg0135297102	G -> DEL	N	N	silent_mutation	Average:62.035; most accessible tissue: Zhenshan97 flag leaf, score: 85.388	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135297102	NA	1.07E-24	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	2.73E-10	NA	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	9.88E-12	1.26E-15	mr1008	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	7.39E-11	NA	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	2.36E-13	2.18E-16	mr1009	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	2.27E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	3.30E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	2.46E-23	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	2.79E-18	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	3.62E-15	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	3.62E-08	NA	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	2.46E-09	1.27E-13	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	1.30E-27	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	5.13E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	2.59E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	1.08E-18	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	1.26E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	1.70E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	5.70E-11	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	4.21E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102	NA	9.83E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251