Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135237999:

Variant ID: vg0135237999 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35237999
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGCTATGGAACTGTTAAGTTCTAACAGAAGGTGGACGGAATGGCACACGGGTCAACGAAAGTTTTTCTCATGACATACAGGTGACTCTAAACTTTTTT[G/T]
TGGCACACATGTAAGTAGTAACTTTTTTTTAAGTTGCATAGGGGTCTTGGTTCTCCTTCTCCTCGCGCCGCCTCTACTCACTCTGGCTCACCGCCCCCCT

Reverse complement sequence

AGGGGGGCGGTGAGCCAGAGTGAGTAGAGGCGGCGCGAGGAGAAGGAGAACCAAGACCCCTATGCAACTTAAAAAAAAGTTACTACTTACATGTGTGCCA[C/A]
AAAAAAGTTTAGAGTCACCTGTATGTCATGAGAAAAACTTTCGTTGACCCGTGTGCCATTCCGTCCACCTTCTGTTAGAACTTAACAGTTCCATAGCTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 35.50% 0.06% 0.02% NA
All Indica  2759 98.10% 1.90% 0.00% 0.00% NA
All Japonica  1512 1.80% 98.20% 0.00% 0.00% NA
Aus  269 98.50% 0.70% 0.37% 0.37% NA
Indica I  595 96.00% 4.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135237999 G -> T LOC_Os01g60920.1 upstream_gene_variant ; 65.0bp to feature; MODIFIER silent_mutation Average:96.642; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N
vg0135237999 G -> T LOC_Os01g60910.2 downstream_gene_variant ; 3626.0bp to feature; MODIFIER silent_mutation Average:96.642; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N
vg0135237999 G -> T LOC_Os01g60910-LOC_Os01g60920 intergenic_region ; MODIFIER silent_mutation Average:96.642; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N
vg0135237999 G -> DEL N N silent_mutation Average:96.642; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0135237999 G T -0.08 -0.1 -0.06 -0.04 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135237999 NA 2.98E-07 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 1.20E-07 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 3.91E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 2.73E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 2.82E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 2.16E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 5.31E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 3.85E-07 4.25E-09 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 1.69E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 1.86E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 9.66E-17 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 2.76E-08 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 1.87E-06 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 3.46E-07 NA mr1538_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 1.22E-36 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135237999 NA 5.58E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251