\
| Variant ID: vg0135124935 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 35124935 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 318. )
AGACCACATGCGACCCTCCGAGAGGATGGACTCTAGAACCACGGAGACCGAGAAAAGTGCCGAGTCGAAAACTTTGAAGTCATGCTCCTTCCACAACTGA[C/T]
AAGAGACTAGGAGAACCAGAGAGTCGAAGCCGGTACAAAAATGCTAAGGTAAACAGGCCCTAGACGACGGCCACCAGACCGCTAGCGAGTTGTATATGTA
TACATATACAACTCGCTAGCGGTCTGGTGGCCGTCGTCTAGGGCCTGTTTACCTTAGCATTTTTGTACCGGCTTCGACTCTCTGGTTCTCCTAGTCTCTT[G/A]
TCAGTTGTGGAAGGAGCATGACTTCAAAGTTTTCGACTCGGCACTTTTCTCGGTCTCCGTGGTTCTAGAGTCCATCCTCTCGGAGGGTCGCATGTGGTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 9.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 70.70% | 29.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 30.40% | 69.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.80% | 33.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0135124935 | C -> T | LOC_Os01g60720.1 | upstream_gene_variant ; 4935.0bp to feature; MODIFIER | silent_mutation | Average:71.922; most accessible tissue: Callus, score: 90.286 | N | N | N | N |
| vg0135124935 | C -> T | LOC_Os01g60730.1 | upstream_gene_variant ; 1949.0bp to feature; MODIFIER | silent_mutation | Average:71.922; most accessible tissue: Callus, score: 90.286 | N | N | N | N |
| vg0135124935 | C -> T | LOC_Os01g60730.2 | upstream_gene_variant ; 1946.0bp to feature; MODIFIER | silent_mutation | Average:71.922; most accessible tissue: Callus, score: 90.286 | N | N | N | N |
| vg0135124935 | C -> T | LOC_Os01g60740.1 | downstream_gene_variant ; 4923.0bp to feature; MODIFIER | silent_mutation | Average:71.922; most accessible tissue: Callus, score: 90.286 | N | N | N | N |
| vg0135124935 | C -> T | LOC_Os01g60730-LOC_Os01g60740 | intergenic_region ; MODIFIER | silent_mutation | Average:71.922; most accessible tissue: Callus, score: 90.286 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0135124935 | NA | 9.72E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 3.24E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 4.18E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 1.35E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 7.81E-07 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | 3.65E-07 | NA | mr1241_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 1.39E-12 | mr1241_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 2.85E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 3.22E-06 | mr1319_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 9.11E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 2.34E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 7.70E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 9.18E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 7.63E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 4.01E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 8.00E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 5.58E-06 | mr1467_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 3.00E-06 | mr1470_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 1.09E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 6.42E-10 | mr1784_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 3.09E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 1.89E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 1.14E-08 | mr1862_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135124935 | NA | 2.70E-06 | mr1923_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |