\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135062105:

Variant ID: vg0135062105 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35062105
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTGTCAAATCATGGCGCAATTAGGCTTGAAAGATTTGTCTCGCAATTTTCTGACGAACTATGTAATTGATTTTTTTATCTACATTTAATACTGTATG[T/C]
ATGTGTCTAAATATTTAAGGTGACAACGTGAAAAATTTTGTTTTGGACTAAGCAGGCCCTCAGTTGATCAGATGAGAGATCCACATGGAACACAGGACTC

Reverse complement sequence

GAGTCCTGTGTTCCATGTGGATCTCTCATCTGATCAACTGAGGGCCTGCTTAGTCCAAAACAAAATTTTTCACGTTGTCACCTTAAATATTTAGACACAT[A/G]
CATACAGTATTAAATGTAGATAAAAAAATCAATTACATAGTTCGTCAGAAAATTGCGAGACAAATCTTTCAAGCCTAATTGCGCCATGATTTGACAATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 22.00% 1.46% 0.00% NA
All Indica  2759 96.90% 3.00% 0.07% 0.00% NA
All Japonica  1512 45.80% 50.20% 4.03% 0.00% NA
Aus  269 36.40% 63.60% 0.00% 0.00% NA
Indica I  595 95.10% 4.90% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 93.80% 6.00% 0.25% 0.00% NA
Temperate Japonica  767 22.90% 71.10% 6.00% 0.00% NA
Tropical Japonica  504 75.60% 22.60% 1.79% 0.00% NA
Japonica Intermediate  241 56.00% 41.50% 2.49% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 70.00% 24.40% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135062105 T -> C LOC_Os01g60640.1 upstream_gene_variant ; 629.0bp to feature; MODIFIER silent_mutation Average:89.997; most accessible tissue: Minghui63 flower, score: 95.545 N N N N
vg0135062105 T -> C LOC_Os01g60650.1 downstream_gene_variant ; 1564.0bp to feature; MODIFIER silent_mutation Average:89.997; most accessible tissue: Minghui63 flower, score: 95.545 N N N N
vg0135062105 T -> C LOC_Os01g60630-LOC_Os01g60640 intergenic_region ; MODIFIER silent_mutation Average:89.997; most accessible tissue: Minghui63 flower, score: 95.545 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0135062105 T C -0.02 -0.03 -0.03 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135062105 NA 8.32E-17 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 1.25E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 2.41E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 5.23E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 6.37E-07 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 6.23E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 9.06E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 4.69E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 3.63E-11 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 2.21E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 1.85E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 4.63E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 2.00E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 6.97E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 1.33E-06 4.76E-10 mr1568_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 1.01E-06 1.01E-06 mr1568_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 8.53E-11 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 1.15E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135062105 NA 1.27E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251