\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135058637:

Variant ID: vg0135058637 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35058637
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.28, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGCGTATTAGCTTTTATTTATGTAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATATAGAGACTAAAGTTAAGTCCCTG[A/G,T]
ATCCAAACACCATCTTAGGCGTTGATTAGTGGCTGAGAATTGAGATGACCCGCGGGAATCGATCACACGTATCTCAGTTAGTTCTAGGAAGAAACCAATT

Reverse complement sequence

AATTGGTTTCTTCCTAGAACTAACTGAGATACGTGTGATCGATTCCCGCGGGTCATCTCAATTCTCAGCCACTAATCAACGCCTAAGATGGTGTTTGGAT[T/C,A]
CAGGGACTTAACTTTAGTCTCTATATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTACATAAATAAAAGCTAATACGCGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 33.40% 0.11% 0.00% T: 0.25%
All Indica  2759 97.70% 2.20% 0.11% 0.00% NA
All Japonica  1512 8.20% 91.70% 0.00% 0.00% T: 0.07%
Aus  269 96.30% 0.70% 0.37% 0.00% T: 2.60%
Indica I  595 96.30% 3.50% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 95.40% 4.50% 0.13% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 18.50% 81.50% 0.00% 0.00% NA
Japonica Intermediate  241 7.90% 91.70% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 7.30% 88.50% 0.00% 0.00% T: 4.17%
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135058637 A -> G LOC_Os01g60640.1 upstream_gene_variant ; 4097.0bp to feature; MODIFIER silent_mutation Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0135058637 A -> G LOC_Os01g60630-LOC_Os01g60640 intergenic_region ; MODIFIER silent_mutation Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0135058637 A -> T LOC_Os01g60640.1 upstream_gene_variant ; 4097.0bp to feature; MODIFIER silent_mutation Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0135058637 A -> T LOC_Os01g60630-LOC_Os01g60640 intergenic_region ; MODIFIER silent_mutation Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135058637 NA 6.10E-07 mr1095 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637 NA 4.26E-06 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637 NA 2.07E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637 2.86E-06 2.86E-06 mr1589 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637 1.60E-06 1.60E-06 mr1918 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637 7.52E-06 7.53E-06 mr1996 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637 NA 7.67E-06 mr1098_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251