\
| Variant ID: vg0135058637 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 35058637 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.28, others allele: 0.00, population size: 107. )
CTCGCGTATTAGCTTTTATTTATGTAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATATAGAGACTAAAGTTAAGTCCCTG[A/G,T]
ATCCAAACACCATCTTAGGCGTTGATTAGTGGCTGAGAATTGAGATGACCCGCGGGAATCGATCACACGTATCTCAGTTAGTTCTAGGAAGAAACCAATT
AATTGGTTTCTTCCTAGAACTAACTGAGATACGTGTGATCGATTCCCGCGGGTCATCTCAATTCTCAGCCACTAATCAACGCCTAAGATGGTGTTTGGAT[T/C,A]
CAGGGACTTAACTTTAGTCTCTATATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTACATAAATAAAAGCTAATACGCGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 33.40% | 0.11% | 0.00% | T: 0.25% |
| All Indica | 2759 | 97.70% | 2.20% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 8.20% | 91.70% | 0.00% | 0.00% | T: 0.07% |
| Aus | 269 | 96.30% | 0.70% | 0.37% | 0.00% | T: 2.60% |
| Indica I | 595 | 96.30% | 3.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 4.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 18.50% | 81.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.90% | 91.70% | 0.00% | 0.00% | T: 0.41% |
| VI/Aromatic | 96 | 7.30% | 88.50% | 0.00% | 0.00% | T: 4.17% |
| Intermediate | 90 | 50.00% | 48.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0135058637 | A -> G | LOC_Os01g60640.1 | upstream_gene_variant ; 4097.0bp to feature; MODIFIER | silent_mutation | Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0135058637 | A -> G | LOC_Os01g60630-LOC_Os01g60640 | intergenic_region ; MODIFIER | silent_mutation | Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0135058637 | A -> T | LOC_Os01g60640.1 | upstream_gene_variant ; 4097.0bp to feature; MODIFIER | silent_mutation | Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0135058637 | A -> T | LOC_Os01g60630-LOC_Os01g60640 | intergenic_region ; MODIFIER | silent_mutation | Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0135058637 | NA | 6.10E-07 | mr1095 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135058637 | NA | 4.26E-06 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135058637 | NA | 2.07E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135058637 | 2.86E-06 | 2.86E-06 | mr1589 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135058637 | 1.60E-06 | 1.60E-06 | mr1918 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135058637 | 7.52E-06 | 7.53E-06 | mr1996 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135058637 | NA | 7.67E-06 | mr1098_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |