\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135050354:

Variant ID: vg0135050354 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35050354
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TGCACGTTAGGACGCGGAAGGGGACTCCGGACGCACCCTCTCCTTCCTCTTCCCCGGCCCGAGGCCGGAGAGATCGCTCCCGTGCCGTCGGCCCATCGTC[G/A]
CTGCGCCCCGTCCGCACGGTAGTGCATCTCCCCGTTCTCCCTCCTCAATCCATCTCTTCCCCTTAGTTTTCGGTAGTAGCATGTATAGCCTCCCCGTAGC

Reverse complement sequence

GCTACGGGGAGGCTATACATGCTACTACCGAAAACTAAGGGGAAGAGATGGATTGAGGAGGGAGAACGGGGAGATGCACTACCGTGCGGACGGGGCGCAG[C/T]
GACGATGGGCCGACGGCACGGGAGCGATCTCTCCGGCCTCGGGCCGGGGAAGAGGAAGGAGAGGGTGCGTCCGGAGTCCCCTTCCGCGTCCTAACGTGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.80% 21.30% 3.13% 2.77% NA
All Indica  2759 88.90% 2.30% 4.24% 4.60% NA
All Japonica  1512 37.70% 60.80% 1.32% 0.13% NA
Aus  269 98.10% 0.40% 1.49% 0.00% NA
Indica I  595 89.40% 4.00% 4.54% 2.02% NA
Indica II  465 75.90% 0.60% 7.53% 15.91% NA
Indica III  913 96.70% 0.20% 2.08% 0.99% NA
Indica Intermediate  786 87.00% 4.30% 4.58% 4.07% NA
Temperate Japonica  767 14.50% 84.20% 1.04% 0.26% NA
Tropical Japonica  504 63.10% 34.90% 1.98% 0.00% NA
Japonica Intermediate  241 58.50% 40.70% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 0.00% 4.17% 1.04% NA
Intermediate  90 70.00% 25.60% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135050354 G -> A LOC_Os01g60620.1 upstream_gene_variant ; 2601.0bp to feature; MODIFIER silent_mutation Average:57.856; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 N N N N
vg0135050354 G -> A LOC_Os01g60630.1 downstream_gene_variant ; 2464.0bp to feature; MODIFIER silent_mutation Average:57.856; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 N N N N
vg0135050354 G -> A LOC_Os01g60620-LOC_Os01g60630 intergenic_region ; MODIFIER silent_mutation Average:57.856; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 N N N N
vg0135050354 G -> DEL N N silent_mutation Average:57.856; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135050354 NA 9.70E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 2.47E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 2.11E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 2.56E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 3.69E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 1.77E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 1.28E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 1.22E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 3.38E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 3.70E-06 NA mr1449_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 2.68E-08 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 3.37E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135050354 NA 2.82E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251