\
| Variant ID: vg0135050354 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 35050354 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 97. )
TGCACGTTAGGACGCGGAAGGGGACTCCGGACGCACCCTCTCCTTCCTCTTCCCCGGCCCGAGGCCGGAGAGATCGCTCCCGTGCCGTCGGCCCATCGTC[G/A]
CTGCGCCCCGTCCGCACGGTAGTGCATCTCCCCGTTCTCCCTCCTCAATCCATCTCTTCCCCTTAGTTTTCGGTAGTAGCATGTATAGCCTCCCCGTAGC
GCTACGGGGAGGCTATACATGCTACTACCGAAAACTAAGGGGAAGAGATGGATTGAGGAGGGAGAACGGGGAGATGCACTACCGTGCGGACGGGGCGCAG[C/T]
GACGATGGGCCGACGGCACGGGAGCGATCTCTCCGGCCTCGGGCCGGGGAAGAGGAAGGAGAGGGTGCGTCCGGAGTCCCCTTCCGCGTCCTAACGTGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.80% | 21.30% | 3.13% | 2.77% | NA |
| All Indica | 2759 | 88.90% | 2.30% | 4.24% | 4.60% | NA |
| All Japonica | 1512 | 37.70% | 60.80% | 1.32% | 0.13% | NA |
| Aus | 269 | 98.10% | 0.40% | 1.49% | 0.00% | NA |
| Indica I | 595 | 89.40% | 4.00% | 4.54% | 2.02% | NA |
| Indica II | 465 | 75.90% | 0.60% | 7.53% | 15.91% | NA |
| Indica III | 913 | 96.70% | 0.20% | 2.08% | 0.99% | NA |
| Indica Intermediate | 786 | 87.00% | 4.30% | 4.58% | 4.07% | NA |
| Temperate Japonica | 767 | 14.50% | 84.20% | 1.04% | 0.26% | NA |
| Tropical Japonica | 504 | 63.10% | 34.90% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.50% | 40.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 4.17% | 1.04% | NA |
| Intermediate | 90 | 70.00% | 25.60% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0135050354 | G -> A | LOC_Os01g60620.1 | upstream_gene_variant ; 2601.0bp to feature; MODIFIER | silent_mutation | Average:57.856; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| vg0135050354 | G -> A | LOC_Os01g60630.1 | downstream_gene_variant ; 2464.0bp to feature; MODIFIER | silent_mutation | Average:57.856; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| vg0135050354 | G -> A | LOC_Os01g60620-LOC_Os01g60630 | intergenic_region ; MODIFIER | silent_mutation | Average:57.856; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| vg0135050354 | G -> DEL | N | N | silent_mutation | Average:57.856; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0135050354 | NA | 9.70E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 2.47E-22 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 2.11E-08 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 2.56E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 3.69E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 1.77E-12 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 1.28E-14 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 1.22E-11 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 3.38E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | 3.70E-06 | NA | mr1449_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 2.68E-08 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 3.37E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135050354 | NA | 2.82E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |