\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135024184:

Variant ID: vg0135024184 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35024184
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CATGATTTTTCGAAGAACTTTTTGGCTCCATGATCGTGCTGGACGATGCACGATGTTGAAGCGAGCTTGCAACACCCCAAAAGCACACTCAATATCTTTC[T/C]
GTTTCCCTTCTTGTTCCCTTGCAAACAGCTTGTGCTTCTCTAGTTGAGGAGATCTTATAGACTTTACAAAGGTTGCCCATTCCGGATAAATTCCATCAGC

Reverse complement sequence

GCTGATGGAATTTATCCGGAATGGGCAACCTTTGTAAAGTCTATAAGATCTCCTCAACTAGAGAAGCACAAGCTGTTTGCAAGGGAACAAGAAGGGAAAC[A/G]
GAAAGATATTGAGTGTGCTTTTGGGGTGTTGCAAGCTCGCTTCAACATCGTGCATCGTCCAGCACGATCATGGAGCCAAAAAGTTCTTCGAAAAATCATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.50% 34.50% 19.91% 3.09% NA
All Indica  2759 7.00% 54.60% 33.13% 5.26% NA
All Japonica  1512 98.20% 0.90% 0.86% 0.07% NA
Aus  269 65.80% 34.20% 0.00% 0.00% NA
Indica I  595 6.10% 44.00% 46.55% 3.36% NA
Indica II  465 1.70% 56.10% 38.92% 3.23% NA
Indica III  913 8.10% 58.70% 25.19% 8.00% NA
Indica Intermediate  786 9.70% 56.90% 28.75% 4.71% NA
Temperate Japonica  767 98.40% 1.00% 0.39% 0.13% NA
Tropical Japonica  504 97.80% 0.60% 1.59% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.83% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 64.40% 20.00% 15.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135024184 T -> DEL N N silent_mutation Average:20.994; most accessible tissue: Callus, score: 33.866 N N N N
vg0135024184 T -> C LOC_Os01g60569.1 upstream_gene_variant ; 3278.0bp to feature; MODIFIER silent_mutation Average:20.994; most accessible tissue: Callus, score: 33.866 N N N N
vg0135024184 T -> C LOC_Os01g60580.1 downstream_gene_variant ; 122.0bp to feature; MODIFIER silent_mutation Average:20.994; most accessible tissue: Callus, score: 33.866 N N N N
vg0135024184 T -> C LOC_Os01g60590.1 downstream_gene_variant ; 1419.0bp to feature; MODIFIER silent_mutation Average:20.994; most accessible tissue: Callus, score: 33.866 N N N N
vg0135024184 T -> C LOC_Os01g60569-LOC_Os01g60580 intergenic_region ; MODIFIER silent_mutation Average:20.994; most accessible tissue: Callus, score: 33.866 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135024184 1.25E-06 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 4.15E-06 7.79E-11 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 2.72E-07 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 3.90E-07 1.42E-11 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 6.31E-09 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 3.19E-10 4.19E-15 mr1008_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 4.29E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 9.14E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 1.31E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 3.83E-07 NA mr1134_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 1.20E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 4.27E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 3.24E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 1.78E-22 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 1.83E-06 NA mr1504_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 4.18E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 4.11E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 2.47E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 9.45E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 2.80E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135024184 NA 2.79E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251