\
| Variant ID: vg0134994521 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 34994521 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATATGAGATCTCACACTTGTATTTCGTTAGAAAAGACTATCACTAATACAAAAAGTCACATACAAGTCGGCACTATAGGTGCCGGAACAGCTAAAACCG[G/A]
CACCTATAGTGTTTTTTCCACCACCCATAGACTGAAAATAAAAAAACCAACACCTTTACCAAAATATATGTGTTGGTTCTACAATAAAACCGCCACCTAT
ATAGGTGGCGGTTTTATTGTAGAACCAACACATATATTTTGGTAAAGGTGTTGGTTTTTTTATTTTCAGTCTATGGGTGGTGGAAAAAACACTATAGGTG[C/T]
CGGTTTTAGCTGTTCCGGCACCTATAGTGCCGACTTGTATGTGACTTTTTGTATTAGTGATAGTCTTTTCTAACGAAATACAAGTGTGAGATCTCATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.90% | 1.00% | 1.10% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 93.90% | 3.10% | 2.98% | 0.00% | NA |
| Aus | 269 | 98.10% | 0.00% | 1.86% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.90% | 2.20% | 2.87% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 10.40% | 8.71% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0134994521 | G -> A | LOC_Os01g60520.1 | upstream_gene_variant ; 2271.0bp to feature; MODIFIER | silent_mutation | Average:43.304; most accessible tissue: Callus, score: 58.851 | N | N | N | N |
| vg0134994521 | G -> A | LOC_Os01g60510.1 | downstream_gene_variant ; 238.0bp to feature; MODIFIER | silent_mutation | Average:43.304; most accessible tissue: Callus, score: 58.851 | N | N | N | N |
| vg0134994521 | G -> A | LOC_Os01g60510-LOC_Os01g60520 | intergenic_region ; MODIFIER | silent_mutation | Average:43.304; most accessible tissue: Callus, score: 58.851 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0134994521 | NA | 1.50E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134994521 | NA | 1.83E-07 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134994521 | NA | 7.69E-07 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134994521 | NA | 2.96E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134994521 | NA | 4.89E-07 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134994521 | 9.14E-06 | 2.01E-06 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134994521 | NA | 6.06E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134994521 | 6.47E-08 | 6.51E-06 | mr1613_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |