\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134994521:

Variant ID: vg0134994521 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34994521
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATATGAGATCTCACACTTGTATTTCGTTAGAAAAGACTATCACTAATACAAAAAGTCACATACAAGTCGGCACTATAGGTGCCGGAACAGCTAAAACCG[G/A]
CACCTATAGTGTTTTTTCCACCACCCATAGACTGAAAATAAAAAAACCAACACCTTTACCAAAATATATGTGTTGGTTCTACAATAAAACCGCCACCTAT

Reverse complement sequence

ATAGGTGGCGGTTTTATTGTAGAACCAACACATATATTTTGGTAAAGGTGTTGGTTTTTTTATTTTCAGTCTATGGGTGGTGGAAAAAACACTATAGGTG[C/T]
CGGTTTTAGCTGTTCCGGCACCTATAGTGCCGACTTGTATGTGACTTTTTGTATTAGTGATAGTCTTTTCTAACGAAATACAAGTGTGAGATCTCATATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.90% 1.00% 1.10% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 93.90% 3.10% 2.98% 0.00% NA
Aus  269 98.10% 0.00% 1.86% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 94.90% 2.20% 2.87% 0.00% NA
Tropical Japonica  504 98.60% 1.00% 0.40% 0.00% NA
Japonica Intermediate  241 80.90% 10.40% 8.71% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134994521 G -> A LOC_Os01g60520.1 upstream_gene_variant ; 2271.0bp to feature; MODIFIER silent_mutation Average:43.304; most accessible tissue: Callus, score: 58.851 N N N N
vg0134994521 G -> A LOC_Os01g60510.1 downstream_gene_variant ; 238.0bp to feature; MODIFIER silent_mutation Average:43.304; most accessible tissue: Callus, score: 58.851 N N N N
vg0134994521 G -> A LOC_Os01g60510-LOC_Os01g60520 intergenic_region ; MODIFIER silent_mutation Average:43.304; most accessible tissue: Callus, score: 58.851 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134994521 NA 1.50E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134994521 NA 1.83E-07 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134994521 NA 7.69E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134994521 NA 2.96E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134994521 NA 4.89E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134994521 9.14E-06 2.01E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134994521 NA 6.06E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134994521 6.47E-08 6.51E-06 mr1613_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251