\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134971015:

Variant ID: vg0134971015 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34971015
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


AACAATCTGGTATCAGAGCCTCATCCCCGTTGTGCTAGTTCTACCGAATTCTGCTGCAAAATCCTGAGGGAGGATTGGGATTTTTCTTCGGATTAATCCC[G/A]
CGAAAAGGCAACTTGCCTCCCCTAGGTTAGCGGAATTTGGTCTAGCCCTAACACCGAGACTCGGAGATGGCGCAGGATAGCAGCAAGCTGGATCTGCTGC

Reverse complement sequence

GCAGCAGATCCAGCTTGCTGCTATCCTGCGCCATCTCCGAGTCTCGGTGTTAGGGCTAGACCAAATTCCGCTAACCTAGGGGAGGCAAGTTGCCTTTTCG[C/T]
GGGATTAATCCGAAGAAAAATCCCAATCCTCCCTCAGGATTTTGCAGCAGAATTCGGTAGAACTAGCACAACGGGGATGAGGCTCTGATACCAGATTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 49.80% 0.23% 0.00% NA
All Indica  2759 19.90% 79.70% 0.36% 0.00% NA
All Japonica  1512 98.10% 1.90% 0.00% 0.00% NA
Aus  269 65.40% 34.60% 0.00% 0.00% NA
Indica I  595 10.10% 89.70% 0.17% 0.00% NA
Indica II  465 3.70% 95.90% 0.43% 0.00% NA
Indica III  913 26.60% 72.80% 0.55% 0.00% NA
Indica Intermediate  786 29.30% 70.50% 0.25% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134971015 G -> A LOC_Os01g60480.1 upstream_gene_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:49.704; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0134971015 G -> A LOC_Os01g60470.1 downstream_gene_variant ; 307.0bp to feature; MODIFIER silent_mutation Average:49.704; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0134971015 G -> A LOC_Os01g60470-LOC_Os01g60480 intergenic_region ; MODIFIER silent_mutation Average:49.704; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134971015 NA 5.10E-22 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 NA 5.49E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 7.01E-06 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 2.70E-07 1.44E-07 mr1008 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 3.75E-06 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 1.10E-07 6.10E-07 mr1009 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 NA 8.99E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 NA 5.63E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 NA 5.58E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 NA 1.63E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 NA 1.61E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 3.27E-06 7.19E-08 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 NA 5.19E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 NA 9.23E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134971015 NA 1.09E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251