\
| Variant ID: vg0134971015 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 34971015 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 272. )
AACAATCTGGTATCAGAGCCTCATCCCCGTTGTGCTAGTTCTACCGAATTCTGCTGCAAAATCCTGAGGGAGGATTGGGATTTTTCTTCGGATTAATCCC[G/A]
CGAAAAGGCAACTTGCCTCCCCTAGGTTAGCGGAATTTGGTCTAGCCCTAACACCGAGACTCGGAGATGGCGCAGGATAGCAGCAAGCTGGATCTGCTGC
GCAGCAGATCCAGCTTGCTGCTATCCTGCGCCATCTCCGAGTCTCGGTGTTAGGGCTAGACCAAATTCCGCTAACCTAGGGGAGGCAAGTTGCCTTTTCG[C/T]
GGGATTAATCCGAAGAAAAATCCCAATCCTCCCTCAGGATTTTGCAGCAGAATTCGGTAGAACTAGCACAACGGGGATGAGGCTCTGATACCAGATTGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 49.80% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 19.90% | 79.70% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 65.40% | 34.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 10.10% | 89.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 3.70% | 95.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 26.60% | 72.80% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 29.30% | 70.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0134971015 | G -> A | LOC_Os01g60480.1 | upstream_gene_variant ; 67.0bp to feature; MODIFIER | silent_mutation | Average:49.704; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0134971015 | G -> A | LOC_Os01g60470.1 | downstream_gene_variant ; 307.0bp to feature; MODIFIER | silent_mutation | Average:49.704; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0134971015 | G -> A | LOC_Os01g60470-LOC_Os01g60480 | intergenic_region ; MODIFIER | silent_mutation | Average:49.704; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0134971015 | NA | 5.10E-22 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | NA | 5.49E-06 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | 7.01E-06 | NA | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | 2.70E-07 | 1.44E-07 | mr1008 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | 3.75E-06 | NA | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | 1.10E-07 | 6.10E-07 | mr1009 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | NA | 8.99E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | NA | 5.63E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | NA | 5.58E-12 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | NA | 1.63E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | NA | 1.61E-06 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | 3.27E-06 | 7.19E-08 | mr1008_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | NA | 5.19E-07 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | NA | 9.23E-07 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134971015 | NA | 1.09E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |