Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134943001:

Variant ID: vg0134943001 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34943001
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCTCCATTCAAACAAAAGTGATGCGGGACCCAATGATATTCAAACAAAAGTGATGCGGGACCCAATGATGAGTGAGGCTGACATGTGGGCCCGGGTGG[T/C]
ATTTGGGAATGAAATTTTGGGAGAGTGGCATTTGGGCACTGGCATTTTGAGAGGGTGGCAAATAGTAAATTCTCCCCAGACACGTGCATTCTCACGTACC

Reverse complement sequence

GGTACGTGAGAATGCACGTGTCTGGGGAGAATTTACTATTTGCCACCCTCTCAAAATGCCAGTGCCCAAATGCCACTCTCCCAAAATTTCATTCCCAAAT[A/G]
CCACCCGGGCCCACATGTCAGCCTCACTCATCATTGGGTCCCGCATCACTTTTGTTTGAATATCATTGGGTCCCGCATCACTTTTGTTTGAATGGAGAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.30% 4.70% 9.65% 62.42% NA
All Indica  2759 4.10% 0.30% 3.26% 92.32% NA
All Japonica  1512 63.00% 7.90% 14.81% 14.35% NA
Aus  269 0.70% 24.90% 30.86% 43.49% NA
Indica I  595 5.50% 0.00% 3.87% 90.59% NA
Indica II  465 0.90% 0.20% 3.87% 95.05% NA
Indica III  913 3.60% 0.00% 1.86% 94.52% NA
Indica Intermediate  786 5.50% 1.00% 4.07% 89.44% NA
Temperate Japonica  767 71.60% 4.20% 15.25% 9.00% NA
Tropical Japonica  504 70.00% 5.40% 5.36% 19.25% NA
Japonica Intermediate  241 20.70% 24.90% 33.20% 21.16% NA
VI/Aromatic  96 0.00% 21.90% 48.96% 29.17% NA
Intermediate  90 36.70% 4.40% 13.33% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134943001 T -> DEL N N silent_mutation Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59 N N N N
vg0134943001 T -> C LOC_Os01g60420.1 upstream_gene_variant ; 807.0bp to feature; MODIFIER silent_mutation Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59 N N N N
vg0134943001 T -> C LOC_Os01g60430.1 upstream_gene_variant ; 3617.0bp to feature; MODIFIER silent_mutation Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59 N N N N
vg0134943001 T -> C LOC_Os01g60410.1 downstream_gene_variant ; 1005.0bp to feature; MODIFIER silent_mutation Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59 N N N N
vg0134943001 T -> C LOC_Os01g60410.3 downstream_gene_variant ; 1005.0bp to feature; MODIFIER silent_mutation Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59 N N N N
vg0134943001 T -> C LOC_Os01g60410.2 downstream_gene_variant ; 1005.0bp to feature; MODIFIER silent_mutation Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59 N N N N
vg0134943001 T -> C LOC_Os01g60410-LOC_Os01g60420 intergenic_region ; MODIFIER silent_mutation Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0134943001 T C -0.02 -0.02 -0.02 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134943001 NA 7.26E-07 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001 NA 9.33E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001 NA 8.02E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001 NA 9.81E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001 3.49E-06 7.77E-08 mr1120 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001 NA 4.80E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001 NA 4.27E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001 NA 2.11E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001 NA 4.26E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001 NA 9.42E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251