Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0134943001:

Variant ID: vg0134943001 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34943001
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCTCCATTCAAACAAAAGTGATGCGGGACCCAATGATATTCAAACAAAAGTGATGCGGGACCCAATGATGAGTGAGGCTGACATGTGGGCCCGGGTGG[T/C]
ATTTGGGAATGAAATTTTGGGAGAGTGGCATTTGGGCACTGGCATTTTGAGAGGGTGGCAAATAGTAAATTCTCCCCAGACACGTGCATTCTCACGTACC

Reverse complement sequence

GGTACGTGAGAATGCACGTGTCTGGGGAGAATTTACTATTTGCCACCCTCTCAAAATGCCAGTGCCCAAATGCCACTCTCCCAAAATTTCATTCCCAAAT[A/G]
CCACCCGGGCCCACATGTCAGCCTCACTCATCATTGGGTCCCGCATCACTTTTGTTTGAATATCATTGGGTCCCGCATCACTTTTGTTTGAATGGAGAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.30%	4.70%	9.65%	62.42%	NA
All Indica	2759	4.10%	0.30%	3.26%	92.32%	NA
All Japonica	1512	63.00%	7.90%	14.81%	14.35%	NA
Aus	269	0.70%	24.90%	30.86%	43.49%	NA
Indica I	595	5.50%	0.00%	3.87%	90.59%	NA
Indica II	465	0.90%	0.20%	3.87%	95.05%	NA
Indica III	913	3.60%	0.00%	1.86%	94.52%	NA
Indica Intermediate	786	5.50%	1.00%	4.07%	89.44%	NA
Temperate Japonica	767	71.60%	4.20%	15.25%	9.00%	NA
Tropical Japonica	504	70.00%	5.40%	5.36%	19.25%	NA
Japonica Intermediate	241	20.70%	24.90%	33.20%	21.16%	NA
VI/Aromatic	96	0.00%	21.90%	48.96%	29.17%	NA
Intermediate	90	36.70%	4.40%	13.33%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134943001	T -> DEL	N	N	silent_mutation	Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59	N	N	N	N
vg0134943001	T -> C	LOC_Os01g60420.1	upstream_gene_variant ; 807.0bp to feature; MODIFIER	silent_mutation	Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59	N	N	N	N
vg0134943001	T -> C	LOC_Os01g60430.1	upstream_gene_variant ; 3617.0bp to feature; MODIFIER	silent_mutation	Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59	N	N	N	N
vg0134943001	T -> C	LOC_Os01g60410.1	downstream_gene_variant ; 1005.0bp to feature; MODIFIER	silent_mutation	Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59	N	N	N	N
vg0134943001	T -> C	LOC_Os01g60410.3	downstream_gene_variant ; 1005.0bp to feature; MODIFIER	silent_mutation	Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59	N	N	N	N
vg0134943001	T -> C	LOC_Os01g60410.2	downstream_gene_variant ; 1005.0bp to feature; MODIFIER	silent_mutation	Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59	N	N	N	N
vg0134943001	T -> C	LOC_Os01g60410-LOC_Os01g60420	intergenic_region ; MODIFIER	silent_mutation	Average:93.938; most accessible tissue: Zhenshan97 root, score: 99.59	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0134943001	T	C	-0.02	-0.02	-0.02	0.0	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134943001	NA	7.26E-07	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001	NA	9.33E-07	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001	NA	8.02E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001	NA	9.81E-07	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001	3.49E-06	7.77E-08	mr1120	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001	NA	4.80E-07	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001	NA	4.27E-07	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001	NA	2.11E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001	NA	4.26E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134943001	NA	9.42E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251