Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134942609:

Variant ID: vg0134942609 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 34942609
Reference Allele: TC	Alternative Allele: AC,TTTTTCGGTGC,TTTTCGGGTGC,T
Primary Allele: AC	Secondary Allele: TC

Inferred Ancestral Allele : TC (evidence from allele frequency in Oryza rufipogon: TC: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGGTTATCTTAACCTGGTGGCCTATTAGCTCAGCTGGTTAGAGCGTCGTGCTAATAACGCGAAGGTCGCAGGTTCGAGACCTGCATGGGCCACCTTTT[TC/AC,TTTTTCGGTGC,TTTTCGGGTGC,T]
TTTTGTACTCACTCACTCAGCAGCGCCATTAATCATGAGCAGAAACACAAACAGCCAAAAGGACGAGCCAACTACTAGACAATACAAAAAGCAACAGTCG

Reverse complement sequence

CGACTGTTGCTTTTTGTATTGTCTAGTAGTTGGCTCGTCCTTTTGGCTGTTTGTGTTTCTGCTCATGATTAATGGCGCTGCTGAGTGAGTGAGTACAAAA[GA/GT,GCACCGAAAAA,GCACCCGAAAA,A]
AAAAGGTGGCCCATGCAGGTCTCGAACCTGCGACCTTCGCGTTATTAGCACGACGCTCTAACCAGCTGAGCTAATAGGCCACCAGGTTAAGATAACCTAT

Allele Frequencies:

Populations	Population Size	Frequency of AC(primary allele)	Frequency of TC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.50%	41.70%	1.10%	1.65%	T: 0.04%
All Indica	2759	92.30%	4.20%	1.05%	2.46%	NA
All Japonica	1512	1.90%	96.50%	1.06%	0.53%	NA
Aus	269	2.60%	97.00%	0.37%	0.00%	NA
Indica I	595	91.10%	5.00%	2.35%	1.51%	NA
Indica II	465	92.90%	1.50%	1.29%	4.30%	NA
Indica III	913	95.80%	1.80%	0.22%	2.19%	NA
Indica Intermediate	786	88.80%	7.90%	0.89%	2.42%	NA
Temperate Japonica	767	1.60%	98.30%	0.00%	0.13%	NA
Tropical Japonica	504	2.40%	93.70%	2.78%	1.19%	NA
Japonica Intermediate	241	2.10%	96.70%	0.83%	0.41%	NA
VI/Aromatic	96	7.30%	89.60%	2.08%	1.04%	NA
Intermediate	90	34.40%	57.80%	4.44%	1.11%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134942609	TC -> T	LOC_Os01g60420.1	upstream_gene_variant ; 1198.0bp to feature; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> T	LOC_Os01g60430.1	upstream_gene_variant ; 4008.0bp to feature; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> T	LOC_Os01g60410.1	downstream_gene_variant ; 614.0bp to feature; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> T	LOC_Os01g60410.3	downstream_gene_variant ; 614.0bp to feature; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> T	LOC_Os01g60410.2	downstream_gene_variant ; 614.0bp to feature; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> T	LOC_Os01g60410-LOC_Os01g60420	intergenic_region ; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTTCGGTGC	LOC_Os01g60420.1	upstream_gene_variant ; 1198.0bp to feature; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTTCGGTGC	LOC_Os01g60430.1	upstream_gene_variant ; 4008.0bp to feature; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTTCGGTGC	LOC_Os01g60410.1	downstream_gene_variant ; 614.0bp to feature; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTTCGGTGC	LOC_Os01g60410.3	downstream_gene_variant ; 614.0bp to feature; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTTCGGTGC	LOC_Os01g60410.2	downstream_gene_variant ; 614.0bp to feature; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTTCGGTGC	LOC_Os01g60410-LOC_Os01g60420	intergenic_region ; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> DEL	N	N	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTCGGGTGC	LOC_Os01g60420.1	upstream_gene_variant ; 1198.0bp to feature; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTCGGGTGC	LOC_Os01g60430.1	upstream_gene_variant ; 4008.0bp to feature; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTCGGGTGC	LOC_Os01g60410.1	downstream_gene_variant ; 614.0bp to feature; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTCGGGTGC	LOC_Os01g60410.3	downstream_gene_variant ; 614.0bp to feature; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTCGGGTGC	LOC_Os01g60410.2	downstream_gene_variant ; 614.0bp to feature; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> TTTTCGGGTGC	LOC_Os01g60410-LOC_Os01g60420	intergenic_region ; MODIFIER	N	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> AC	LOC_Os01g60420.1	upstream_gene_variant ; 1199.0bp to feature; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> AC	LOC_Os01g60430.1	upstream_gene_variant ; 4009.0bp to feature; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> AC	LOC_Os01g60410.1	downstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> AC	LOC_Os01g60410.3	downstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> AC	LOC_Os01g60410.2	downstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N
vg0134942609	TC -> AC	LOC_Os01g60410-LOC_Os01g60420	intergenic_region ; MODIFIER	silent_mutation	Average:99.077; most accessible tissue: Zhenshan97 root, score: 99.84	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0134942609	TC	AC	0.0	-0.04	-0.04	-0.02	-0.05	-0.07
vg0134942609	TC	T	0.21	0.21	0.15	0.05	0.09	0.1
vg0134942609	TC	TTTTC*	-0.03	-0.01	0.12	0.09	0.14	0.16
vg0134942609	TC	TTTTT*	-0.01	-0.03	0.12	0.08	0.14	0.16

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134942609	NA	4.30E-22	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	4.72E-09	NA	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	1.25E-09	6.51E-15	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	5.16E-09	NA	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	6.61E-10	1.05E-14	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	1.28E-12	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	1.18E-07	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	1.27E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	9.87E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	3.96E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	9.75E-23	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	2.45E-18	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	6.11E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	1.70E-29	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	2.04E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	2.64E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	2.07E-32	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	5.76E-30	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	1.09E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	1.81E-11	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	1.06E-07	NA	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	1.27E-09	2.32E-15	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	8.00E-07	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	5.07E-26	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	2.24E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	2.91E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	2.72E-34	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	7.04E-26	mr1244_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	6.22E-27	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	3.42E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	1.14E-24	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	1.76E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	8.63E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	3.73E-15	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	1.25E-44	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	2.32E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	3.28E-34	mr1932_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134942609	NA	2.09E-61	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251