\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134802811:

Variant ID: vg0134802811 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34802811
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAGCCTGCAAATGAGGTCGTGTGTGTGCCGCCCTTGCTTTCTTTTGTTCTTTGCATGTGCTTGCGAGCTGGGTCTTTTGCGTCACTGCGTGTGAGGCG[T/C]
CTGCCAATTGGTTATCATCAGTAGCATCTCACCGTTGACAGCTTACAGAAATCAGAGGTTCTTGCGAGGTCTGGCCGTCTGGATGAAGTACTCCTAGTTC

Reverse complement sequence

GAACTAGGAGTACTTCATCCAGACGGCCAGACCTCGCAAGAACCTCTGATTTCTGTAAGCTGTCAACGGTGAGATGCTACTGATGATAACCAATTGGCAG[A/G]
CGCCTCACACGCAGTGACGCAAAAGACCCAGCTCGCAAGCACATGCAAAGAACAAAAGAAAGCAAGGGCGGCACACACACGACCTCATTTGCAGGCTGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 5.30% 0.11% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 85.10% 14.60% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 93.50% 6.40% 0.13% 0.00% NA
Tropical Japonica  504 75.80% 23.80% 0.40% 0.00% NA
Japonica Intermediate  241 77.60% 21.60% 0.83% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134802811 T -> C LOC_Os01g60190.1 upstream_gene_variant ; 1473.0bp to feature; MODIFIER silent_mutation Average:95.18; most accessible tissue: Zhenshan97 flower, score: 99.61 N N N N
vg0134802811 T -> C LOC_Os01g60190.2 upstream_gene_variant ; 1568.0bp to feature; MODIFIER silent_mutation Average:95.18; most accessible tissue: Zhenshan97 flower, score: 99.61 N N N N
vg0134802811 T -> C LOC_Os01g60160.1 downstream_gene_variant ; 1983.0bp to feature; MODIFIER silent_mutation Average:95.18; most accessible tissue: Zhenshan97 flower, score: 99.61 N N N N
vg0134802811 T -> C LOC_Os01g60170.1 downstream_gene_variant ; 550.0bp to feature; MODIFIER silent_mutation Average:95.18; most accessible tissue: Zhenshan97 flower, score: 99.61 N N N N
vg0134802811 T -> C LOC_Os01g60180.1 downstream_gene_variant ; 681.0bp to feature; MODIFIER silent_mutation Average:95.18; most accessible tissue: Zhenshan97 flower, score: 99.61 N N N N
vg0134802811 T -> C LOC_Os01g60170-LOC_Os01g60180 intergenic_region ; MODIFIER silent_mutation Average:95.18; most accessible tissue: Zhenshan97 flower, score: 99.61 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0134802811 T C -0.01 -0.04 -0.04 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134802811 3.01E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 1.85E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 3.13E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 1.13E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 8.73E-07 2.83E-09 mr1289_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 NA 8.60E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 NA 2.32E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 2.55E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 NA 2.45E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 NA 6.35E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 NA 2.95E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 NA 2.32E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 1.71E-07 NA mr1778_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134802811 NA 3.14E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251