\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134784290:

Variant ID: vg0134784290 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34784290
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


GCGTGTGGCTGCGCGCCTGCGCCCCCGGGGCCACTCCGGCGTTTCGCGTGGGCAACTGGGCAACCGCACCGTTCGACGGGCCGAGGGGCGACGAGGACTC[G/A]
GAGGCGGGAGCGCTGGTGCGCTGCGCGCCTGCGCGTGCGGAGGCGGGAGCGCTGCCGAGGCGACGGACCGGCGTTGGGTGAGAGATCGCAGGCACCTGTC

Reverse complement sequence

GACAGGTGCCTGCGATCTCTCACCCAACGCCGGTCCGTCGCCTCGGCAGCGCTCCCGCCTCCGCACGCGCAGGCGCGCAGCGCACCAGCGCTCCCGCCTC[C/T]
GAGTCCTCGTCGCCCCTCGGCCCGTCGAACGGTGCGGTTGCCCAGTTGCCCACGCGAAACGCCGGAGTGGCCCCGGGGGCGCAGGCGCGCAGCCACACGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.70% 0.04% 0.00% NA
All Indica  2759 97.10% 2.90% 0.00% 0.00% NA
All Japonica  1512 2.00% 98.00% 0.00% 0.00% NA
Aus  269 39.80% 59.90% 0.37% 0.00% NA
Indica I  595 96.50% 3.50% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.50% 0.00% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 35.60% 63.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134784290 G -> A LOC_Os01g60120.2 upstream_gene_variant ; 3427.0bp to feature; MODIFIER silent_mutation Average:98.763; most accessible tissue: Zhenshan97 root, score: 99.509 N N N N
vg0134784290 G -> A LOC_Os01g60140.1 upstream_gene_variant ; 4111.0bp to feature; MODIFIER silent_mutation Average:98.763; most accessible tissue: Zhenshan97 root, score: 99.509 N N N N
vg0134784290 G -> A LOC_Os01g60120.3 upstream_gene_variant ; 3427.0bp to feature; MODIFIER silent_mutation Average:98.763; most accessible tissue: Zhenshan97 root, score: 99.509 N N N N
vg0134784290 G -> A LOC_Os01g60130.1 downstream_gene_variant ; 1111.0bp to feature; MODIFIER silent_mutation Average:98.763; most accessible tissue: Zhenshan97 root, score: 99.509 N N N N
vg0134784290 G -> A LOC_Os01g60120-LOC_Os01g60130 intergenic_region ; MODIFIER silent_mutation Average:98.763; most accessible tissue: Zhenshan97 root, score: 99.509 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0134784290 G A -0.01 -0.05 -0.08 0.04 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134784290 NA 2.38E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.46E-12 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 9.86E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.02E-61 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.62E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.15E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.20E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 7.01E-68 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 2.93E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.07E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.16E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.12E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 4.93E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 6.79E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 2.26E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 3.12E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 2.02E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 8.38E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.47E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 2.94E-07 NA mr1383_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 3.53E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 7.16E-59 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 2.78E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 2.99E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.33E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 2.74E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 1.51E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 2.24E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134784290 NA 2.43E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251