\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134671199:

Variant ID: vg0134671199 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34671199
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCGAATTGGAATTTGCATGTTTGTTAAGTGATATATTACATATTAACCTATCTTGTAAAATTTTTTTAAAATATTTTCATAATCATTTAGGTGGCATG[T/C,A]
AAGAAATGGGTGGACGTCCACTCGAGAGATTAGAACCCATCCTCCATGTGCAGAACTGAAGGAGTAGCCAGAAAGAAACTTGAAAAGCTGACAGCGAAGT

Reverse complement sequence

ACTTCGCTGTCAGCTTTTCAAGTTTCTTTCTGGCTACTCCTTCAGTTCTGCACATGGAGGATGGGTTCTAATCTCTCGAGTGGACGTCCACCCATTTCTT[A/G,T]
CATGCCACCTAAATGATTATGAAAATATTTTAAAAAAATTTTACAAGATAGGTTAATATGTAATATATCACTTAACAAACATGCAAATTCCAATTCGACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 34.70% 2.22% 0.00% A: 0.25%
All Indica  2759 83.50% 12.60% 3.44% 0.00% A: 0.43%
All Japonica  1512 28.40% 71.40% 0.26% 0.00% NA
Aus  269 37.20% 62.80% 0.00% 0.00% NA
Indica I  595 59.50% 29.10% 10.76% 0.00% A: 0.67%
Indica II  465 96.80% 1.10% 2.15% 0.00% NA
Indica III  913 90.60% 9.00% 0.22% 0.00% A: 0.22%
Indica Intermediate  786 85.50% 11.30% 2.42% 0.00% A: 0.76%
Temperate Japonica  767 11.70% 88.00% 0.26% 0.00% NA
Tropical Japonica  504 45.00% 55.00% 0.00% 0.00% NA
Japonica Intermediate  241 46.50% 52.70% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 4.20% 2.08% 0.00% NA
Intermediate  90 51.10% 44.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134671199 T -> A LOC_Os01g59970.1 downstream_gene_variant ; 3285.0bp to feature; MODIFIER silent_mutation Average:95.0; most accessible tissue: Zhenshan97 young leaf, score: 96.524 N N N N
vg0134671199 T -> A LOC_Os01g59950-LOC_Os01g59970 intergenic_region ; MODIFIER silent_mutation Average:95.0; most accessible tissue: Zhenshan97 young leaf, score: 96.524 N N N N
vg0134671199 T -> C LOC_Os01g59970.1 downstream_gene_variant ; 3285.0bp to feature; MODIFIER silent_mutation Average:95.0; most accessible tissue: Zhenshan97 young leaf, score: 96.524 N N N N
vg0134671199 T -> C LOC_Os01g59950-LOC_Os01g59970 intergenic_region ; MODIFIER silent_mutation Average:95.0; most accessible tissue: Zhenshan97 young leaf, score: 96.524 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0134671199 T A 0.01 0.03 0.02 -0.01 0.02 0.01
vg0134671199 T C 0.0 0.0 -0.01 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134671199 NA 2.30E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 3.20E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 3.89E-16 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 4.45E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.51E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 3.16E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.07E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.49E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.74E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 2.13E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 6.43E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 2.36E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 2.07E-10 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.44E-06 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 6.48E-13 mr1219 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.64E-12 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 6.08E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 2.55E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 5.32E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 7.29E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.35E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 6.05E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 2.40E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 5.86E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 2.64E-08 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 2.82E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.07E-08 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 3.70E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.69E-10 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.05E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 1.08E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134671199 NA 2.07E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251