\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134540544:

Variant ID: vg0134540544 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34540544
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAATCATGCATTTTAGAGCATTTTGGATTTTTCGCATATTTCGGTGTTTAATTGCATAACGTGTACTTTGTATAGATGATTGCTTAAACGGTGAAGAA[A/G]
TGATTTAGGTGCTGACATTTTCTAGTTACAAGGCAAGTCCCACCTCCCTATCTCTTTTGATCACTTTGAACCTATGTTTGGAGGTTATTGAAAATGTTTG

Reverse complement sequence

CAAACATTTTCAATAACCTCCAAACATAGGTTCAAAGTGATCAAAAGAGATAGGGAGGTGGGACTTGCCTTGTAACTAGAAAATGTCAGCACCTAAATCA[T/C]
TTCTTCACCGTTTAAGCAATCATCTATACAAAGTACACGTTATGCAATTAAACACCGAAATATGCGAAAAATCCAAAATGCTCTAAAATGCATGATTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 25.00% 0.51% 9.84% NA
All Indica  2759 97.80% 2.00% 0.00% 0.18% NA
All Japonica  1512 2.40% 71.90% 1.19% 24.54% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.70% 0.10% 0.00% 0.22% NA
Indica Intermediate  786 95.80% 3.80% 0.00% 0.38% NA
Temperate Japonica  767 1.60% 93.00% 0.26% 5.22% NA
Tropical Japonica  504 2.80% 54.20% 2.58% 40.48% NA
Japonica Intermediate  241 4.10% 41.90% 1.24% 52.70% NA
VI/Aromatic  96 16.70% 0.00% 4.17% 79.17% NA
Intermediate  90 43.30% 40.00% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134540544 A -> G LOC_Os01g59700.1 downstream_gene_variant ; 3098.0bp to feature; MODIFIER silent_mutation Average:30.081; most accessible tissue: Callus, score: 41.812 N N N N
vg0134540544 A -> G LOC_Os01g59700-LOC_Os01g59710 intergenic_region ; MODIFIER silent_mutation Average:30.081; most accessible tissue: Callus, score: 41.812 N N N N
vg0134540544 A -> DEL N N silent_mutation Average:30.081; most accessible tissue: Callus, score: 41.812 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134540544 2.48E-07 2.09E-121 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 4.33E-07 9.93E-119 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 NA 2.69E-14 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 NA 1.49E-71 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 NA 1.37E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 NA 1.92E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 1.14E-06 2.08E-95 mr1517 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 NA 3.72E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 NA 2.19E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 1.41E-07 4.12E-125 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 NA 4.57E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 NA 1.10E-86 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 NA 4.28E-69 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 NA 8.87E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 4.16E-08 8.31E-137 mr1517_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134540544 1.45E-06 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251