Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134494458:

Variant ID: vg0134494458 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34494458
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, C: 0.24, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

GCATTTTCATTTCTCGAGAGAATATATAATTATAAAAAAGTAACAATGTAAATTAATACAAATGTATCGTTACGCAAATATACAAGTTCAAATTTCACAA[C/G]
ACCAAACCCTTATAACTAGAGCCCAGGTGCAAGATGTTATAGGCTTTAATAGATGAGACCGTTGATTTTTTATATATATGTTCAATTATTTATCATATTA

Reverse complement sequence

TAATATGATAAATAATTGAACATATATATAAAAAATCAACGGTCTCATCTATTAAAGCCTATAACATCTTGCACCTGGGCTCTAGTTATAAGGGTTTGGT[G/C]
TTGTGAAATTTGAACTTGTATATTTGCGTAACGATACATTTGTATTAATTTACATTGTTACTTTTTTATAATTATATATTCTCTCGAGAAATGAAAATGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	30.00%	0.06%	0.00%	NA
All Indica	2759	90.40%	9.50%	0.07%	0.00%	NA
All Japonica	1512	26.30%	73.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	93.40%	6.60%	0.00%	0.00%	NA
Indica II	465	80.90%	19.10%	0.00%	0.00%	NA
Indica III	913	94.10%	5.90%	0.00%	0.00%	NA
Indica Intermediate	786	89.60%	10.20%	0.25%	0.00%	NA
Temperate Japonica	767	6.90%	93.10%	0.00%	0.00%	NA
Tropical Japonica	504	45.20%	54.80%	0.00%	0.00%	NA
Japonica Intermediate	241	48.50%	51.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	54.40%	44.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134494458	C -> G	LOC_Os01g59630.1	upstream_gene_variant ; 4647.0bp to feature; MODIFIER	silent_mutation	Average:51.974; most accessible tissue: Callus, score: 90.068	N	N	N	N
vg0134494458	C -> G	LOC_Os01g59640.1	upstream_gene_variant ; 1762.0bp to feature; MODIFIER	silent_mutation	Average:51.974; most accessible tissue: Callus, score: 90.068	N	N	N	N
vg0134494458	C -> G	LOC_Os01g59640-LOC_Os01g59660	intergenic_region ; MODIFIER	silent_mutation	Average:51.974; most accessible tissue: Callus, score: 90.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134494458	NA	1.47E-07	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494458	NA	6.19E-07	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494458	NA	1.56E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494458	NA	4.25E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494458	NA	1.13E-08	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494458	NA	9.80E-06	mr1375	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494458	2.30E-06	1.62E-07	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494458	NA	2.43E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494458	2.03E-06	8.23E-09	mr1871_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494458	NA	3.21E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251