Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134494318:

Variant ID: vg0134494318 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34494318
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.36, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTGTGTGTGGATGGGATATATATGCAGGCATGCTTGCGTTGTGCACCGAAAATTTTGTAGCTAGCTCATCACTTTGGGAGGTCACCTTCTTTTGTTGG[C/T]
TAGTAACATCAGCAACCAATGCATTGTTATTTAGGGAAAGCATTTTCATTTCTCGAGAGAATATATAATTATAAAAAAGTAACAATGTAAATTAATACAA

Reverse complement sequence

TTGTATTAATTTACATTGTTACTTTTTTATAATTATATATTCTCTCGAGAAATGAAAATGCTTTCCCTAAATAACAATGCATTGGTTGCTGATGTTACTA[G/A]
CCAACAAAAGAAGGTGACCTCCCAAAGTGATGAGCTAGCTACAAAATTTTCGGTGCACAACGCAAGCATGCCTGCATATATATCCCATCCACACACACAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 40.10% 0.06% 0.00% NA
All Indica  2759 90.40% 9.60% 0.00% 0.00% NA
All Japonica  1512 1.80% 98.00% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.90% 6.10% 0.00% 0.00% NA
Indica II  465 80.90% 19.10% 0.00% 0.00% NA
Indica III  913 93.90% 6.10% 0.00% 0.00% NA
Indica Intermediate  786 89.20% 10.80% 0.00% 0.00% NA
Temperate Japonica  767 1.40% 98.40% 0.13% 0.00% NA
Tropical Japonica  504 2.20% 97.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.10% 0.83% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 33.30% 66.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134494318 C -> T LOC_Os01g59630.1 upstream_gene_variant ; 4507.0bp to feature; MODIFIER silent_mutation Average:67.412; most accessible tissue: Zhenshan97 flower, score: 94.443 N N N N
vg0134494318 C -> T LOC_Os01g59640.1 upstream_gene_variant ; 1622.0bp to feature; MODIFIER silent_mutation Average:67.412; most accessible tissue: Zhenshan97 flower, score: 94.443 N N N N
vg0134494318 C -> T LOC_Os01g59640-LOC_Os01g59660 intergenic_region ; MODIFIER silent_mutation Average:67.412; most accessible tissue: Zhenshan97 flower, score: 94.443 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0134494318 C T -0.01 -0.08 -0.04 -0.02 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134494318 6.12E-06 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 8.25E-06 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 1.62E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 1.30E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 2.10E-07 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 6.81E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 7.85E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 3.24E-29 mr1375 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 7.10E-06 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 2.88E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 5.11E-08 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 4.83E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 6.12E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134494318 NA 1.88E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251