\
| Variant ID: vg0134467592 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 34467592 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGAGGCTGGGTGTGGCGAGGGGGGTGACGTTTTTTTTTATTCACCCAAAATATTTTCGCAGGTGGGTGGATACGACGCCTACGAAGATAGAGGTGCTGC[C/A]
TGTGAAAATCAACTATTTTCACAGGCTTATGCGTACAGGCGAGCCTTCCCCCGTCTGAGAAAATGATTTTTAGCTGTCTGGGAAAACGATTTTTCTAGCC
GGCTAGAAAAATCGTTTTCCCAGACAGCTAAAAATCATTTTCTCAGACGGGGGAAGGCTCGCCTGTACGCATAAGCCTGTGAAAATAGTTGATTTTCACA[G/T]
GCAGCACCTCTATCTTCGTAGGCGTCGTATCCACCCACCTGCGAAAATATTTTGGGTGAATAAAAAAAAACGTCACCCCCCTCGCCACACCCAGCCTCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 6.90% | 3.60% | 1.16% | NA |
| All Indica | 2759 | 99.30% | 0.10% | 0.11% | 0.47% | NA |
| All Japonica | 1512 | 68.10% | 19.40% | 10.25% | 2.25% | NA |
| Aus | 269 | 97.00% | 0.00% | 0.00% | 2.97% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.20% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 98.60% | 0.10% | 0.13% | 1.15% | NA |
| Temperate Japonica | 767 | 94.50% | 1.20% | 3.65% | 0.65% | NA |
| Tropical Japonica | 504 | 37.30% | 43.80% | 17.66% | 1.19% | NA |
| Japonica Intermediate | 241 | 48.50% | 26.10% | 15.77% | 9.54% | NA |
| VI/Aromatic | 96 | 77.10% | 18.80% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 13.30% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0134467592 | C -> A | LOC_Os01g59580.1 | upstream_gene_variant ; 1582.0bp to feature; MODIFIER | silent_mutation | Average:62.928; most accessible tissue: Zhenshan97 root, score: 75.275 | N | N | N | N |
| vg0134467592 | C -> A | LOC_Os01g59600.1 | upstream_gene_variant ; 3422.0bp to feature; MODIFIER | silent_mutation | Average:62.928; most accessible tissue: Zhenshan97 root, score: 75.275 | N | N | N | N |
| vg0134467592 | C -> A | LOC_Os01g59600.2 | upstream_gene_variant ; 3428.0bp to feature; MODIFIER | silent_mutation | Average:62.928; most accessible tissue: Zhenshan97 root, score: 75.275 | N | N | N | N |
| vg0134467592 | C -> A | LOC_Os01g59580-LOC_Os01g59600 | intergenic_region ; MODIFIER | silent_mutation | Average:62.928; most accessible tissue: Zhenshan97 root, score: 75.275 | N | N | N | N |
| vg0134467592 | C -> DEL | N | N | silent_mutation | Average:62.928; most accessible tissue: Zhenshan97 root, score: 75.275 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0134467592 | 1.36E-06 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134467592 | 1.31E-08 | 7.21E-16 | mr1484 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134467592 | NA | 8.05E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |