\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134393590:

Variant ID: vg0134393590 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34393590
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AATAAACTCATTAGTCCCTTAATCGTATTCATCATTACACCAAAACCCACTAGGGGGATAAATACAACTTCAATATTTTCTCCTCACTCTTTAATATGAA[T/C]
AGATTTGTGAAGGCAAGGGTATATTGGTCATTTCATGCGCCCAGTCCATGTTGGCATGCACATGTGGTGGTGTTAACGACCAAATTTGGTAGATCATAGA

Reverse complement sequence

TCTATGATCTACCAAATTTGGTCGTTAACACCACCACATGTGCATGCCAACATGGACTGGGCGCATGAAATGACCAATATACCCTTGCCTTCACAAATCT[A/G]
TTCATATTAAAGAGTGAGGAGAAAATATTGAAGTTGTATTTATCCCCCTAGTGGGTTTTGGTGTAATGATGAATACGATTAAGGGACTAATGAGTTTATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 21.20% 0.08% 0.00% NA
All Indica  2759 98.00% 2.00% 0.00% 0.00% NA
All Japonica  1512 38.50% 61.20% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.80% 0.00% 0.00% NA
Temperate Japonica  767 14.50% 85.00% 0.52% 0.00% NA
Tropical Japonica  504 63.50% 36.50% 0.00% 0.00% NA
Japonica Intermediate  241 62.70% 37.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134393590 T -> C LOC_Os01g59460.1 upstream_gene_variant ; 3714.0bp to feature; MODIFIER silent_mutation Average:34.147; most accessible tissue: Zhenshan97 young leaf, score: 50.0 N N N N
vg0134393590 T -> C LOC_Os01g59470.1 upstream_gene_variant ; 4840.0bp to feature; MODIFIER silent_mutation Average:34.147; most accessible tissue: Zhenshan97 young leaf, score: 50.0 N N N N
vg0134393590 T -> C LOC_Os01g59450.1 downstream_gene_variant ; 4184.0bp to feature; MODIFIER silent_mutation Average:34.147; most accessible tissue: Zhenshan97 young leaf, score: 50.0 N N N N
vg0134393590 T -> C LOC_Os01g59450-LOC_Os01g59460 intergenic_region ; MODIFIER silent_mutation Average:34.147; most accessible tissue: Zhenshan97 young leaf, score: 50.0 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134393590 NA 1.11E-08 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134393590 1.40E-06 NA mr1679 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134393590 2.03E-07 NA mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134393590 1.96E-06 NA mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134393590 NA 1.13E-31 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251