\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134387944:

Variant ID: vg0134387944 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34387944
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTACCCTAGACTTTTCTGTCACAAAGCTAATGCCTTAACTAACTTTTTGTGAAAAATCTATGATCGTGTTTAGTTCTATCCATAGATTGGTTTGGTC[C/A]
TTTTAAATAGCATCTCATGTCATCTTTACCCTGCATATTTGAACTATTCCCTTATGATTCAGCTCCTTATTCTGTTGTGCTGTTAATTATCTCCTTGTGT

Reverse complement sequence

ACACAAGGAGATAATTAACAGCACAACAGAATAAGGAGCTGAATCATAAGGGAATAGTTCAAATATGCAGGGTAAAGATGACATGAGATGCTATTTAAAA[G/T]
GACCAAACCAATCTATGGATAGAACTAAACACGATCATAGATTTTTCACAAAAAGTTAGTTAAGGCATTAGCTTTGTGACAGAAAAGTCTAGGGTAGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 14.20% 0.15% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 63.50% 36.10% 0.40% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 86.60% 12.60% 0.78% 0.00% NA
Tropical Japonica  504 39.30% 60.70% 0.00% 0.00% NA
Japonica Intermediate  241 40.70% 59.30% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134387944 C -> A LOC_Os01g59440.1 downstream_gene_variant ; 4860.0bp to feature; MODIFIER silent_mutation Average:53.915; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0134387944 C -> A LOC_Os01g59440.3 downstream_gene_variant ; 4860.0bp to feature; MODIFIER silent_mutation Average:53.915; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0134387944 C -> A LOC_Os01g59450.1 intron_variant ; MODIFIER silent_mutation Average:53.915; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134387944 NA 4.70E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944 9.06E-08 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944 3.93E-06 NA mr1693 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944 1.59E-09 NA mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944 4.09E-07 1.49E-06 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944 NA 3.88E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944 NA 1.58E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944 NA 8.41E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944 NA 1.49E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251