Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0134374494:

Variant ID: vg0134374494 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34374494
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

CTAACGCAACCTATAGAGTTTGTAGCTTTCTACTTGGTAGGGACAGGGGTTCGTGGTAGACTTACTTGTCTATGCAGGCGTGAAACAATCTTCCTTTCCT[C/T]
TGGACTTTGAGGCGGCCGGGCTGTGTTTCCCCAGCGGCCACCCAGTGGCGGCAGATTTGACCACAAGCAGCTTAGACCCAGTTGCTATGGGGAACAAAGG

Reverse complement sequence

CCTTTGTTCCCCATAGCAACTGGGTCTAAGCTGCTTGTGGTCAAATCTGCCGCCACTGGGTGGCCGCTGGGGAAACACAGCCCGGCCGCCTCAAAGTCCA[G/A]
AGGAAAGGAAGATTGTTTCACGCCTGCATAGACAAGTAAGTCTACCACGAACCCCTGTCCCTACCAAGTAGAAAGCTACAAACTCTATAGGTTGCGTTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.80%	15.10%	0.04%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	62.60%	37.30%	0.07%	0.00%	NA
Aus	269	95.90%	4.10%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	86.70%	13.20%	0.13%	0.00%	NA
Tropical Japonica	504	36.70%	63.30%	0.00%	0.00%	NA
Japonica Intermediate	241	40.20%	59.80%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	88.50%	1.04%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134374494	C -> T	LOC_Os01g59440.1	upstream_gene_variant ; 4602.0bp to feature; MODIFIER	silent_mutation	Average:44.597; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0134374494	C -> T	LOC_Os01g59440.2	upstream_gene_variant ; 4602.0bp to feature; MODIFIER	silent_mutation	Average:44.597; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0134374494	C -> T	LOC_Os01g59430.1	downstream_gene_variant ; 1364.0bp to feature; MODIFIER	silent_mutation	Average:44.597; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0134374494	C -> T	LOC_Os01g59420-LOC_Os01g59430	intergenic_region ; MODIFIER	silent_mutation	Average:44.597; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134374494	NA	8.10E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134374494	6.35E-08	NA	mr1679	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134374494	1.04E-11	8.95E-12	mr1720	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134374494	3.41E-08	3.44E-07	mr1720	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134374494	NA	8.09E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134374494	NA	6.97E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134374494	NA	4.51E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134374494	NA	1.22E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134374494	NA	2.35E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251