Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134313386:

Variant ID: vg0134313386 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 34313386
Reference Allele: AGAGGAG	Alternative Allele: AGAGGAGGAG,AGAGGAGGAGGAGGAG,AGAGGAGGAGGAG,GGAGGAG,A,AGAG
Primary Allele: AGAGGAG	Secondary Allele: AGAGGAGGAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTTGAGGTTGAGGTTGGGTTGGGTTGGGTGAGCAGAAGTGCCTCGAATTCCGGGCATTTTATAATGATTTCTTGGTTTTGCGAACACCATTGGAGGAGG[AGAGGAG/AGAGGAGGAG,AGAGGAGGAGGAGGAG,AGAGGAGGAGGAG,GGAGGAG,A,AGAG]
GAGGAGGAGGAGTGACGTTTGGACCATAGCAATCTCTAGGCGGGACCGCGGGAGCCATCCTCTGCCACCTCACCCGTCGTGGGCTACTATGAGGCTGATC

Reverse complement sequence

GATCAGCCTCATAGTAGCCCACGACGGGTGAGGTGGCAGAGGATGGCTCCCGCGGTCCCGCCTAGAGATTGCTATGGTCCAAACGTCACTCCTCCTCCTC[CTCCTCT/CTCCTCCTCT,CTCCTCCTCCTCCTCT,CTCCTCCTCCTCT,CTCCTCC,T,CTCT]
CCTCCTCCAATGGTGTTCGCAAAACCAAGAAATCATTATAAAATGCCCGGAATTCGAGGCACTTCTGCTCACCCAACCCAACCCAACCTCAACCTCAACC

Allele Frequencies:

Populations	Population Size	Frequency of AGAGGAG(primary allele)	Frequency of AGAGGAGGAG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.30%	23.40%	5.25%	6.07%	AGAGGAGGAGGAGGAG: 12.44%; AGAGGAGGAGGAG: 3.72%; GGAGGAG: 3.03%; A: 0.70%; AGAG: 0.08%
All Indica	2759	34.50%	39.20%	1.74%	0.11%	AGAGGAGGAGGAGGAG: 20.91%; AGAGGAGGAGGAG: 2.39%; A: 1.09%; GGAGGAG: 0.04%
All Japonica	1512	66.20%	0.30%	10.32%	14.29%	GGAGGAG: 8.66%; AGAGGAGGAGGAGGAG: 0.13%; AGAG: 0.07%
Aus	269	49.10%	4.80%	6.32%	0.00%	AGAGGAGGAGGAG: 39.78%
Indica I	595	27.10%	66.70%	3.53%	0.00%	AGAGGAGGAGGAGGAG: 2.69%
Indica II	465	73.10%	4.10%	0.43%	0.00%	AGAGGAGGAGGAGGAG: 21.94%; AGAGGAGGAGGAG: 0.22%; A: 0.22%
Indica III	913	15.60%	47.90%	0.66%	0.22%	AGAGGAGGAGGAGGAG: 28.37%; AGAGGAGGAGGAG: 5.04%; A: 2.30%
Indica Intermediate	786	39.40%	29.00%	2.42%	0.13%	AGAGGAGGAGGAGGAG: 25.45%; AGAGGAGGAGGAG: 2.42%; A: 1.02%; GGAGGAG: 0.13%
Temperate Japonica	767	92.40%	0.10%	5.08%	1.04%	GGAGGAG: 1.17%; AGAG: 0.13%
Tropical Japonica	504	37.10%	0.60%	13.29%	34.33%	GGAGGAG: 14.68%
Japonica Intermediate	241	43.60%	0.40%	20.75%	14.52%	GGAGGAG: 19.92%; AGAGGAGGAGGAGGAG: 0.83%
VI/Aromatic	96	12.50%	1.00%	22.92%	59.38%	GGAGGAG: 2.08%; AGAGGAGGAGGAG: 2.08%
Intermediate	90	45.60%	8.90%	5.56%	12.22%	GGAGGAG: 10.00%; AGAGGAGGAGGAGGAG: 10.00%; A: 3.33%; AGAG: 3.33%; AGAGGAGGAGGAG: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134313386	AGAGGAG -> GGAGGAG	LOC_Os01g59350.1	upstream_gene_variant ; 67.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> GGAGGAG	LOC_Os01g59350.2	upstream_gene_variant ; 67.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> GGAGGAG	LOC_Os01g59350-LOC_Os01g59360	intergenic_region ; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> A	LOC_Os01g59350.1	upstream_gene_variant ; 68.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> A	LOC_Os01g59350.2	upstream_gene_variant ; 68.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> A	LOC_Os01g59350-LOC_Os01g59360	intergenic_region ; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAGGAGGAGGAG	LOC_Os01g59350.1	upstream_gene_variant ; 74.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAGGAGGAGGAG	LOC_Os01g59350.2	upstream_gene_variant ; 74.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAGGAGGAGGAG	LOC_Os01g59350-LOC_Os01g59360	intergenic_region ; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> DEL	N	N	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAGGAGGAG	LOC_Os01g59350.1	upstream_gene_variant ; 74.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAGGAGGAG	LOC_Os01g59350.2	upstream_gene_variant ; 74.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAGGAGGAG	LOC_Os01g59350-LOC_Os01g59360	intergenic_region ; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAG	LOC_Os01g59350.1	upstream_gene_variant ; 71.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAG	LOC_Os01g59350.2	upstream_gene_variant ; 71.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAG	LOC_Os01g59350-LOC_Os01g59360	intergenic_region ; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAGGAGGAGGAGGAG	LOC_Os01g59350.1	upstream_gene_variant ; 74.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAGGAGGAGGAGGAG	LOC_Os01g59350.2	upstream_gene_variant ; 74.0bp to feature; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N
vg0134313386	AGAGGAG -> AGAGGAGGAGGAGGAG	LOC_Os01g59350-LOC_Os01g59360	intergenic_region ; MODIFIER	silent_mutation	Average:92.688; most accessible tissue: Zhenshan97 root, score: 98.003	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0134313386	AGAGG*	A	0.15	0.28	0.33	0.19	0.24	0.15
vg0134313386	AGAGG*	AGAG	0.09	0.18	0.22	0.16	0.17	0.11
vg0134313386	AGAGG*	AGAGG*	0.1	0.05	0.08	-0.01	0.02	-0.02
vg0134313386	AGAGG*	GGAGG*	0.03	0.01	-0.01	0.02	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134313386	NA	2.59E-06	mr1720	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134313386	3.47E-06	3.47E-06	mr1065_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134313386	NA	3.40E-07	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251