Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134310167:

Variant ID: vg0134310167 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34310167
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, A: 0.18, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:

ACTCTCAAGGTTTTGGATATATGCCTGCAGAAAATAAATGATGAAACCATACAAAGCATCCAAAAGAGCACAAACTGAAGAAAAAGGGCTAATTTTTTTT[A/T]
AAAAAAAATGCTTATCTAATCTACAATTGCAAATACTATCATGGTTTAGGACAAGTTTATAGGCTACTAATGGAATTTCAGGGTAAAAATAATCCGTAAC

Reverse complement sequence

GTTACGGATTATTTTTACCCTGAAATTCCATTAGTAGCCTATAAACTTGTCCTAAACCATGATAGTATTTGCAATTGTAGATTAGATAAGCATTTTTTTT[T/A]
AAAAAAAATTAGCCCTTTTTCTTCAGTTTGTGCTCTTTTGGATGCTTTGTATGGTTTCATCATTTATTTTCTGCAGGCATATATCCAAAACCTTGAGAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.40%	19.80%	1.80%	0.00%	NA
All Indica	2759	95.30%	4.50%	0.25%	0.00%	NA
All Japonica	1512	53.40%	42.00%	4.56%	0.00%	NA
Aus	269	42.80%	55.40%	1.86%	0.00%	NA
Indica I	595	99.00%	0.20%	0.84%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	91.60%	8.40%	0.00%	0.00%	NA
Indica Intermediate	786	95.00%	4.70%	0.25%	0.00%	NA
Temperate Japonica	767	42.60%	49.30%	8.08%	0.00%	NA
Tropical Japonica	504	73.40%	26.00%	0.60%	0.00%	NA
Japonica Intermediate	241	46.10%	52.30%	1.66%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	70.00%	26.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134310167	A -> T	LOC_Os01g59340.1	downstream_gene_variant ; 4187.0bp to feature; MODIFIER	silent_mutation	Average:38.547; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0134310167	A -> T	LOC_Os01g59340.3	downstream_gene_variant ; 3118.0bp to feature; MODIFIER	silent_mutation	Average:38.547; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0134310167	A -> T	LOC_Os01g59340.2	downstream_gene_variant ; 4187.0bp to feature; MODIFIER	silent_mutation	Average:38.547; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0134310167	A -> T	LOC_Os01g59350.1	intron_variant ; MODIFIER	silent_mutation	Average:38.547; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0134310167	A -> T	LOC_Os01g59350.2	intron_variant ; MODIFIER	silent_mutation	Average:38.547; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134310167	NA	4.50E-07	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134310167	NA	4.55E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134310167	NA	3.34E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134310167	7.51E-06	7.51E-06	mr1525_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134310167	NA	3.81E-07	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134310167	NA	2.47E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134310167	NA	8.03E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134310167	NA	2.80E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251