\
| Variant ID: vg0134277481 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 34277481 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 82. )
TCATGGACACCCCTTCATTTTATTTCCGTGCGGTTCGTAAGTGAAACCATACAGAAAAATGGAGAAACCGGCGCAGTCCATCGCCCTGATTTTCCTAACC[C/T]
GCACACAAAAATAGCCAATCCGCTGATATCCTCGCACGCGCGCCCCGCCCACTGCCTTCTCTCTCACCTCACTCTCTCCCTCTCTGGCTCTCTCCCACTC
GAGTGGGAGAGAGCCAGAGAGGGAGAGAGTGAGGTGAGAGAGAAGGCAGTGGGCGGGGCGCGCGTGCGAGGATATCAGCGGATTGGCTATTTTTGTGTGC[G/A]
GGTTAGGAAAATCAGGGCGATGGACTGCGCCGGTTTCTCCATTTTTCTGTATGGTTTCACTTACGAACCGCACGGAAATAAAATGAAGGGGTGTCCATGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 35.10% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 3.90% | 96.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 3.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 4.80% | 95.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 3.20% | 96.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 89.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 62.20% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0134277481 | C -> T | LOC_Os01g59290.1 | downstream_gene_variant ; 2183.0bp to feature; MODIFIER | silent_mutation | Average:67.16; most accessible tissue: Zhenshan97 flower, score: 77.165 | N | N | N | N |
| vg0134277481 | C -> T | LOC_Os01g59300.1 | intron_variant ; MODIFIER | silent_mutation | Average:67.16; most accessible tissue: Zhenshan97 flower, score: 77.165 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0134277481 | NA | 4.30E-21 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | 2.47E-08 | 5.42E-128 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | 7.34E-08 | 3.22E-125 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 5.00E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 2.94E-78 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 1.79E-80 | mr1015 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 1.24E-25 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 1.91E-12 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 8.70E-23 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | 2.06E-06 | 6.79E-96 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | 3.82E-06 | 2.02E-71 | mr1538 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 3.14E-35 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 4.60E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 3.57E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 4.44E-08 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 3.95E-124 | mr1008_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 3.24E-90 | mr1015_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 3.81E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 8.38E-135 | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 2.06E-102 | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134277481 | NA | 2.23E-11 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |