\
| Variant ID: vg0134236787 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 34236787 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 327. )
TCCCAGATATATTATGTTTCCACCAAATAATTCCATATGCGACCTGACTAGCCTGTTGCCGCTAGTCTACTCGCCCTTCGCACTTGCAAACTATCCATCT[G/A]
TAGAACCTTCTTGTCCTTCTTCTGGATCCGTTAACAAGTTCCTGCAACGAACCACACATCCGTTGAACCCGGTCTAACCGTCCAAACTCCGCAGTCTAAC
GTTAGACTGCGGAGTTTGGACGGTTAGACCGGGTTCAACGGATGTGTGGTTCGTTGCAGGAACTTGTTAACGGATCCAGAAGAAGGACAAGAAGGTTCTA[C/T]
AGATGGATAGTTTGCAAGTGCGAAGGGCGAGTAGACTAGCGGCAACAGGCTAGTCAGGTCGCATATGGAATTATTTGGTGGAAACATAATATATCTGGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.30% | 13.80% | 0.06% | 0.87% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 62.40% | 34.90% | 0.20% | 2.51% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 88.40% | 7.20% | 0.00% | 4.43% | NA |
| Tropical Japonica | 504 | 34.10% | 65.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 38.60% | 58.50% | 1.24% | 1.66% | NA |
| VI/Aromatic | 96 | 10.40% | 86.50% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0134236787 | G -> A | LOC_Os01g59230.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.444; most accessible tissue: Zhenshan97 flower, score: 78.317 | N | N | N | N |
| vg0134236787 | G -> DEL | N | N | silent_mutation | Average:62.444; most accessible tissue: Zhenshan97 flower, score: 78.317 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0134236787 | NA | 5.63E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | NA | 4.63E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | 7.93E-07 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | 4.57E-07 | NA | mr1691 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | 1.52E-06 | NA | mr1691 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | 9.32E-07 | NA | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | 9.04E-06 | NA | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | NA | 3.90E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | NA | 2.70E-08 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | NA | 1.04E-06 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | NA | 3.82E-07 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | NA | 7.05E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134236787 | NA | 1.11E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |