\
| Variant ID: vg0134125967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 34125967 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, G: 0.23, others allele: 0.00, population size: 163. )
TACAGAGTTTACTACAAAGCCATGACAACTTAAGCACCTTGTGCCAAACATTATACACCAAAAGGCCTAACCACTCTCCTTCAAACCAATCCTAATAACA[T/G]
ATGTACTACCCCCAAAACCCTGAAATGGGATGAGATCACCCTGCCTGAGAAATGGGTTTTATCTCAAGCTGTTGAACCTAAGTCTATGGATCAATCAGAA
TTCTGATTGATCCATAGACTTAGGTTCAACAGCTTGAGATAAAACCCATTTCTCAGGCAGGGTGATCTCATCCCATTTCAGGGTTTTGGGGGTAGTACAT[A/C]
TGTTATTAGGATTGGTTTGAAGGAGAGTGGTTAGGCCTTTTGGTGTATAATGTTTGGCACAAGGTGCTTAAGTTGTCATGGCTTTGTAGTAAACTCTGTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 7.00% | 27.99% | 13.37% | NA |
| All Indica | 2759 | 33.40% | 10.70% | 34.51% | 21.38% | NA |
| All Japonica | 1512 | 89.00% | 1.00% | 9.99% | 0.00% | NA |
| Aus | 269 | 4.80% | 6.30% | 76.58% | 12.27% | NA |
| Indica I | 595 | 24.70% | 6.90% | 23.19% | 45.21% | NA |
| Indica II | 465 | 75.70% | 2.20% | 18.06% | 4.09% | NA |
| Indica III | 913 | 10.30% | 21.70% | 52.25% | 15.77% | NA |
| Indica Intermediate | 786 | 41.90% | 5.90% | 32.19% | 20.10% | NA |
| Temperate Japonica | 767 | 90.50% | 0.30% | 9.26% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 1.00% | 6.35% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 3.30% | 19.92% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 3.12% | 2.08% | NA |
| Intermediate | 90 | 76.70% | 3.30% | 12.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0134125967 | T -> G | LOC_Os01g59040.1 | upstream_gene_variant ; 642.0bp to feature; MODIFIER | silent_mutation | Average:21.364; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0134125967 | T -> G | LOC_Os01g59040-LOC_Os01g59050 | intergenic_region ; MODIFIER | silent_mutation | Average:21.364; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg0134125967 | T -> DEL | N | N | silent_mutation | Average:21.364; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0134125967 | NA | 5.14E-07 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 3.84E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | 4.36E-06 | 4.34E-06 | mr1856 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 1.11E-06 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 8.78E-07 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 6.08E-06 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 7.82E-06 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 1.69E-08 | mr1268_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 4.74E-09 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 7.12E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 3.76E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 4.46E-10 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 2.73E-08 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0134125967 | NA | 7.75E-07 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |