Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134118800:

Variant ID: vg0134118800 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34118800
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCCCACATCACAGCTCTTAGGGCAACAACAATGTATATAGCAAAAGTAGTCCATATAGATAGATCCACTTATACAAACTTTAACTATTGTAACATTCA[C/T]
AATGTATATGGATAGCAAATAGTAGTAGGAGGAGAGAAGAGGTAGAGACAAATAATATATTTTATTCTCTATGGGCAGCCCATATGCTTATGAGTAGCTT

Reverse complement sequence

AAGCTACTCATAAGCATATGGGCTGCCCATAGAGAATAAAATATATTATTTGTCTCTACCTCTTCTCTCCTCCTACTACTATTTGCTATCCATATACATT[G/A]
TGAATGTTACAATAGTTAAAGTTTGTATAAGTGGATCTATCTATATGGACTACTTTTGCTATATACATTGTTGTTGCCCTAAGAGCTGTGATGTGGGAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.90%	6.40%	0.72%	0.00%	NA
All Indica	2759	98.20%	1.80%	0.00%	0.00%	NA
All Japonica	1512	81.70%	16.10%	2.25%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.60%	3.40%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	3.10%	0.00%	0.00%	NA
Temperate Japonica	767	67.30%	28.70%	4.04%	0.00%	NA
Tropical Japonica	504	97.60%	2.40%	0.00%	0.00%	NA
Japonica Intermediate	241	94.20%	4.60%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134118800	C -> T	LOC_Os01g59009.1	downstream_gene_variant ; 4482.0bp to feature; MODIFIER	silent_mutation	Average:59.923; most accessible tissue: Zhenshan97 root, score: 81.564	N	N	N	N
vg0134118800	C -> T	LOC_Os01g59020.1	downstream_gene_variant ; 2039.0bp to feature; MODIFIER	silent_mutation	Average:59.923; most accessible tissue: Zhenshan97 root, score: 81.564	N	N	N	N
vg0134118800	C -> T	LOC_Os01g59030.1	downstream_gene_variant ; 929.0bp to feature; MODIFIER	silent_mutation	Average:59.923; most accessible tissue: Zhenshan97 root, score: 81.564	N	N	N	N
vg0134118800	C -> T	LOC_Os01g59040.1	downstream_gene_variant ; 2429.0bp to feature; MODIFIER	silent_mutation	Average:59.923; most accessible tissue: Zhenshan97 root, score: 81.564	N	N	N	N
vg0134118800	C -> T	LOC_Os01g59030-LOC_Os01g59040	intergenic_region ; MODIFIER	silent_mutation	Average:59.923; most accessible tissue: Zhenshan97 root, score: 81.564	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134118800	NA	1.28E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	4.33E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	1.07E-08	2.19E-15	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	3.10E-06	3.61E-09	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	2.00E-08	6.14E-14	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	1.25E-06	9.39E-09	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	2.38E-09	2.12E-15	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	3.69E-07	2.96E-09	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	8.32E-08	1.35E-12	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	1.78E-06	3.10E-08	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	9.29E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	1.81E-10	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	1.88E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	7.44E-07	NA	mr1035_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	1.14E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	6.36E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	3.15E-07	3.14E-15	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	1.63E-08	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	7.12E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	2.30E-06	4.45E-12	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	3.11E-07	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	2.79E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134118800	NA	6.90E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251