Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134092893:

Variant ID: vg0134092893 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34092893
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATAACGGAATCCTATTTTCGAACGGGATGATCCTGTCGACGTTTGATGTCGTCATTCTGGTATTTGCATAGTATGGGGATCGTCGGTGCTAGGATATAC[G/A]
CGAGACTGAGGTAAAAGAGACGAAGACGGGGATTTTTATACAGGTTCAGGCTCCTGAGTGGTCAGGTAATGGCCCTACATCCTGTTGGCCGGAGCCGGAG

Reverse complement sequence

CTCCGGCTCCGGCCAACAGGATGTAGGGCCATTACCTGACCACTCAGGAGCCTGAACCTGTATAAAAATCCCCGTCTTCGTCTCTTTTACCTCAGTCTCG[C/T]
GTATATCCTAGCACCGACGATCCCCATACTATGCAAATACCAGAATGACGACATCAAACGTCGACAGGATCATCCCGTTCGAAAATAGGATTCCGTTATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	2.50%	3.68%	0.00%	NA
All Indica	2759	89.50%	4.30%	6.23%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	64.20%	11.40%	24.37%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	96.60%	2.70%	0.66%	0.00%	NA
Indica Intermediate	786	94.00%	3.30%	2.67%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134092893	G -> A	LOC_Os01g58990.1	upstream_gene_variant ; 1716.0bp to feature; MODIFIER	silent_mutation	Average:39.934; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N
vg0134092893	G -> A	LOC_Os01g58970.1	downstream_gene_variant ; 1492.0bp to feature; MODIFIER	silent_mutation	Average:39.934; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N
vg0134092893	G -> A	LOC_Os01g58980.1	downstream_gene_variant ; 785.0bp to feature; MODIFIER	silent_mutation	Average:39.934; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N
vg0134092893	G -> A	LOC_Os01g58970-LOC_Os01g58980	intergenic_region ; MODIFIER	silent_mutation	Average:39.934; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134092893	NA	6.37E-06	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	8.39E-08	mr1641	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	1.50E-08	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	4.07E-06	6.43E-07	mr1901	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	1.46E-07	mr1901	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	2.25E-07	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	5.81E-07	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	9.23E-07	NA	mr1011_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	9.95E-07	1.01E-08	mr1011_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	5.41E-08	mr1013_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	2.07E-07	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	1.58E-07	mr1031_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	7.87E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	1.89E-09	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	3.51E-07	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	5.49E-06	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	5.96E-07	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	7.16E-07	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	8.68E-11	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	7.42E-06	mr1832_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	7.19E-06	7.18E-06	mr1832_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	3.41E-06	mr1833_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	2.67E-06	2.67E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134092893	NA	6.13E-08	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251