Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0133884657:

Variant ID: vg0133884657 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33884657
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGATAATATTATAACATACTCTTTTTATTTGTAGGAAGCACTTGCATTTAGCTAGTATATATGCAGTTTGATCCTTCAATTATGTTCGGTTCTTTTGA[A/G]
ATTATCTTCTCCCGTTGTTGCAACGAGAATTTTGCTACTAAATTAAAATGAAAAAAGAAAAAAGTTTGAAAAGAAAGTTTTCTATAAGGGACCGAAGCTT

Reverse complement sequence

AAGCTTCGGTCCCTTATAGAAAACTTTCTTTTCAAACTTTTTTCTTTTTTCATTTTAATTTAGTAGCAAAATTCTCGTTGCAACAACGGGAGAAGATAAT[T/C]
TCAAAAGAACCGAACATAATTGAAGGATCAAACTGCATATATACTAGCTAAATGCAAGTGCTTCCTACAAATAAAAAGAGTATGTTATAATATTATCTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	8.60%	2.56%	0.30%	NA
All Indica	2759	98.00%	1.80%	0.07%	0.14%	NA
All Japonica	1512	69.30%	22.50%	7.54%	0.66%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.60%	3.20%	0.00%	0.17%	NA
Indica II	465	98.90%	0.60%	0.22%	0.22%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	96.80%	2.80%	0.13%	0.25%	NA
Temperate Japonica	767	54.50%	32.50%	11.86%	1.17%	NA
Tropical Japonica	504	89.50%	8.50%	1.98%	0.00%	NA
Japonica Intermediate	241	74.30%	19.90%	5.39%	0.41%	NA
VI/Aromatic	96	94.80%	2.10%	3.12%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133884657	A -> G	LOC_Os01g58600.1	upstream_gene_variant ; 2367.0bp to feature; MODIFIER	silent_mutation	Average:63.472; most accessible tissue: Zhenshan97 flower, score: 81.855	N	N	N	N
vg0133884657	A -> G	LOC_Os01g58610.1	upstream_gene_variant ; 263.0bp to feature; MODIFIER	silent_mutation	Average:63.472; most accessible tissue: Zhenshan97 flower, score: 81.855	N	N	N	N
vg0133884657	A -> G	LOC_Os01g58600-LOC_Os01g58610	intergenic_region ; MODIFIER	silent_mutation	Average:63.472; most accessible tissue: Zhenshan97 flower, score: 81.855	N	N	N	N
vg0133884657	A -> DEL	N	N	silent_mutation	Average:63.472; most accessible tissue: Zhenshan97 flower, score: 81.855	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133884657	2.69E-08	3.60E-14	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133884657	8.91E-06	3.40E-07	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133884657	8.19E-07	7.32E-12	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133884657	NA	4.75E-06	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133884657	2.49E-09	6.98E-16	mr1650	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133884657	2.38E-06	1.94E-07	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133884657	9.26E-07	3.04E-11	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133884657	NA	3.43E-06	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133884657	NA	5.90E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251