\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133840259:

Variant ID: vg0133840259 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33840259
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGCCACCGCGTCTGCTCCTCCTCCTCCGCTTAACCGATCTGACCATCGCCAAAACAGTTACCGGCCAGCTCCCCGAAGGAAGCAAGGAGAAAAAACAA[G/C]
AAGGAAAGAGAAAAAGTGAGAGATGAGATAGCCTCAAGTAGTAGTATACAGAACGGGTATTGATTTGCGAGTGTGTGTATGTGTGTGCTTGTGTAGATTA

Reverse complement sequence

TAATCTACACAAGCACACACATACACACACTCGCAAATCAATACCCGTTCTGTATACTACTACTTGAGGCTATCTCATCTCTCACTTTTTCTCTTTCCTT[C/G]
TTGTTTTTTCTCCTTGCTTCCTTCGGGGAGCTGGCCGGTAACTGTTTTGGCGATGGTCAGATCGGTTAAGCGGAGGAGGAGGAGCAGACGCGGTGGCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.70% 0.21% 0.00% NA
All Indica  2759 98.40% 1.60% 0.04% 0.00% NA
All Japonica  1512 92.70% 6.70% 0.53% 0.00% NA
Aus  269 4.80% 95.20% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.50% 0.13% 0.00% NA
Temperate Japonica  767 88.80% 10.20% 1.04% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133840259 G -> C LOC_Os01g58550.1 3_prime_UTR_variant ; 66.0bp to feature; MODIFIER silent_mutation Average:92.426; most accessible tissue: Zhenshan97 flower, score: 99.777 N N N N
vg0133840259 G -> C LOC_Os01g58550.2 downstream_gene_variant ; 1263.0bp to feature; MODIFIER silent_mutation Average:92.426; most accessible tissue: Zhenshan97 flower, score: 99.777 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0133840259 G C -0.01 0.02 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133840259 NA 3.24E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 1.04E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 6.91E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 4.25E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 8.77E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 3.32E-12 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 2.79E-15 mr1927 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 6.26E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 8.91E-13 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 1.89E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 4.52E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 1.02E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133840259 NA 2.31E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251