RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0133776229:

Variant ID: vg0133776229 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33776229
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGGGCCGTTTAGCATTGAAGCTGTTCTACCAAAATTTTAGTAACTTAGATAGTAGATAAGATAGTTTAGATTGAAACTAAACATTAGTAGTGTCCATG[C/T]
TTAATTTGGCCATATTCTAAGATCTTTTTCACCATACTACTAATTTTTGGCTTCATATTAATATCAAACCAAACATATCCTAGCTAACTTTGTCCTACTA

Reverse complement sequence

TAGTAGGACAAAGTTAGCTAGGATATGTTTGGTTTGATATTAATATGAAGCCAAAAATTAGTAGTATGGTGAAAAAGATCTTAGAATATGGCCAAATTAA[G/A]
CATGGACACTACTAATGTTTAGTTTCAATCTAAACTATCTTATCTACTATCTAAGTTACTAAAATTTTGGTAGAACAGCTTCAATGCTAAACGGCCCTAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.10%	1.80%	0.19%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.04%	0.00%	NA
All Japonica	1512	94.50%	5.00%	0.46%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.30%	0.13%	0.00%	NA
Temperate Japonica	767	92.30%	6.80%	0.91%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	92.50%	7.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133776229	C -> T	LOC_Os01g58440.1	upstream_gene_variant ; 2064.0bp to feature; MODIFIER	silent_mutation	Average:63.833; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N
vg0133776229	C -> T	LOC_Os01g58430-LOC_Os01g58440	intergenic_region ; MODIFIER	silent_mutation	Average:63.833; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133776229	3.73E-06	NA	mr1446	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133776229	7.42E-06	6.65E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133776229	4.93E-06	5.62E-06	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133776229	8.42E-06	5.83E-06	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133776229	2.56E-06	8.76E-07	mr1008_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133776229	4.83E-06	4.82E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0133776229:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact