\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133704031:

Variant ID: vg0133704031 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33704031
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.27, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


TATCTTTACCTATTATAAAATCTTTAAGATGTTTCTGCCAAATATTTTCGTACATCGTCCCACTGCTCAAGTCCGATTCCCTCTCGTGTGCGTTTTTTTG[T/C]
GATTTTTGCGATGTCCATTTCGTCCATCCTTAGTCCTTCCAGTCCGAGTCCAACATAGAAAAAAAAATCCCCAAGCGATCCCCAAATCAATCAATCAACG

Reverse complement sequence

CGTTGATTGATTGATTTGGGGATCGCTTGGGGATTTTTTTTTCTATGTTGGACTCGGACTGGAAGGACTAAGGATGGACGAAATGGACATCGCAAAAATC[A/G]
CAAAAAAACGCACACGAGAGGGAATCGGACTTGAGCAGTGGGACGATGTACGAAAATATTTGGCAGAAACATCTTAAAGATTTTATAATAGGTAAAGATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 3.40% 1.88% 13.52% NA
All Indica  2759 73.60% 0.80% 3.12% 22.44% NA
All Japonica  1512 95.80% 3.40% 0.00% 0.79% NA
Aus  269 68.80% 30.90% 0.37% 0.00% NA
Indica I  595 85.90% 0.00% 1.85% 12.27% NA
Indica II  465 32.00% 0.20% 7.53% 60.22% NA
Indica III  913 89.60% 0.40% 0.55% 9.42% NA
Indica Intermediate  786 70.40% 2.30% 4.45% 22.90% NA
Temperate Japonica  767 94.90% 4.30% 0.00% 0.78% NA
Tropical Japonica  504 99.00% 0.20% 0.00% 0.79% NA
Japonica Intermediate  241 92.10% 7.10% 0.00% 0.83% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 86.70% 4.40% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133704031 T -> DEL N N silent_mutation Average:78.637; most accessible tissue: Zhenshan97 flower, score: 95.833 N N N N
vg0133704031 T -> C LOC_Os01g58335.1 upstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:78.637; most accessible tissue: Zhenshan97 flower, score: 95.833 N N N N
vg0133704031 T -> C LOC_Os01g58310.1 downstream_gene_variant ; 4564.0bp to feature; MODIFIER silent_mutation Average:78.637; most accessible tissue: Zhenshan97 flower, score: 95.833 N N N N
vg0133704031 T -> C LOC_Os01g58320.1 downstream_gene_variant ; 171.0bp to feature; MODIFIER silent_mutation Average:78.637; most accessible tissue: Zhenshan97 flower, score: 95.833 N N N N
vg0133704031 T -> C LOC_Os01g58330.1 downstream_gene_variant ; 930.0bp to feature; MODIFIER silent_mutation Average:78.637; most accessible tissue: Zhenshan97 flower, score: 95.833 N N N N
vg0133704031 T -> C LOC_Os01g58320-LOC_Os01g58330 intergenic_region ; MODIFIER silent_mutation Average:78.637; most accessible tissue: Zhenshan97 flower, score: 95.833 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0133704031 T C -0.01 0.0 0.0 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133704031 NA 2.53E-09 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133704031 NA 5.62E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133704031 NA 4.32E-11 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133704031 NA 1.81E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133704031 NA 2.68E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133704031 NA 9.00E-09 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133704031 5.98E-09 NA mr1008_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251