Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133697207:

Variant ID: vg0133697207 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33697207
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCCAGCGAGTTTGGGAGGGAGGGGGAGGCGGCCGGCGACCAAGAAACAATCTCTTCCTCTGCCTCTTCCTCTTCTCCCACCGGTGGTGCCTCTTCTAG[C/T]
ATCGTCGGCCACCCGCGGGGGCACAGCGTTGGTGGCGGCCGAGCACGGGGGAGCTCCCCGTCCCATCCACTGTCTTCCGCTTCGCCTAGCTCGCCCTCCG

Reverse complement sequence

CGGAGGGCGAGCTAGGCGAAGCGGAAGACAGTGGATGGGACGGGGAGCTCCCCCGTGCTCGGCCGCCACCAACGCTGTGCCCCCGCGGGTGGCCGACGAT[G/A]
CTAGAAGAGGCACCACCGGTGGGAGAAGAGGAAGAGGCAGAGGAAGAGATTGTTTCTTGGTCGCCGGCCGCCTCCCCCTCCCTCCCAAACTCGCTGGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 1.20% 2.16% 3.58% NA
All Indica  2759 90.30% 0.10% 3.62% 6.05% NA
All Japonica  1512 96.40% 3.40% 0.07% 0.13% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 95.30% 0.00% 3.19% 1.51% NA
Indica II  465 66.00% 0.00% 10.75% 23.23% NA
Indica III  913 99.50% 0.00% 0.22% 0.33% NA
Indica Intermediate  786 90.10% 0.30% 3.69% 5.98% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 92.50% 7.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133697207 C -> T LOC_Os01g58300.1 missense_variant ; p.Ala203Thr; MODERATE nonsynonymous_codon ; A203T Average:87.609; most accessible tissue: Zhenshan97 flag leaf, score: 95.628 unknown unknown DELETERIOUS 0.02
vg0133697207 C -> DEL LOC_Os01g58300.1 N frameshift_variant Average:87.609; most accessible tissue: Zhenshan97 flag leaf, score: 95.628 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0133697207 C T 0.02 -0.02 0.02 0.01 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133697207 1.16E-11 9.33E-11 mr1008_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133697207 7.71E-06 7.71E-06 mr1015_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251