Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133688513:

Variant ID: vg0133688513 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33688513
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.36, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTGCTACGGCTGGTTGGCATGTGCCGCTTGCACTTTCCGGTCTTGCTTGCCATCCGCCGCCACCGCCGCCGGCCGCACGGTGACGGACGGCATATGGC[C/T]
TTTTTTAGAGAGAGAGAGAGAGGGGAGTAGAAGGCCGAGAATGATTATAGCCGGGCGTCCGGCGCGGGGAGCCAGATCGGGCGCTCCCCCGCATGCCCGC

Reverse complement sequence

GCGGGCATGCGGGGGAGCGCCCGATCTGGCTCCCCGCGCCGGACGCCCGGCTATAATCATTCTCGGCCTTCTACTCCCCTCTCTCTCTCTCTCTAAAAAA[G/A]
GCCATATGCCGTCCGTCACCGTGCGGCCGGCGGCGGTGGCGGCGGATGGCAAGCAAGACCGGAAAGTGCAAGCGGCACATGCCAACCAGCCGTAGCAAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 36.60% 8.70% 5.82% NA
All Indica  2759 73.00% 4.60% 13.70% 8.74% NA
All Japonica  1512 4.00% 95.60% 0.26% 0.20% NA
Aus  269 79.60% 1.10% 8.55% 10.78% NA
Indica I  595 73.10% 6.20% 15.97% 4.71% NA
Indica II  465 54.80% 1.50% 29.68% 13.98% NA
Indica III  913 84.70% 3.00% 4.16% 8.21% NA
Indica Intermediate  786 70.00% 7.10% 13.61% 9.29% NA
Temperate Japonica  767 4.80% 94.80% 0.13% 0.26% NA
Tropical Japonica  504 0.60% 98.80% 0.40% 0.20% NA
Japonica Intermediate  241 8.30% 91.30% 0.41% 0.00% NA
VI/Aromatic  96 2.10% 96.90% 1.04% 0.00% NA
Intermediate  90 24.40% 67.80% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133688513 C -> T LOC_Os01g58290.1 upstream_gene_variant ; 3260.0bp to feature; MODIFIER silent_mutation Average:74.853; most accessible tissue: Callus, score: 95.7 N N N N
vg0133688513 C -> T LOC_Os01g58290.2 upstream_gene_variant ; 3260.0bp to feature; MODIFIER silent_mutation Average:74.853; most accessible tissue: Callus, score: 95.7 N N N N
vg0133688513 C -> T LOC_Os01g58290.3 upstream_gene_variant ; 3260.0bp to feature; MODIFIER silent_mutation Average:74.853; most accessible tissue: Callus, score: 95.7 N N N N
vg0133688513 C -> T LOC_Os01g58290.4 upstream_gene_variant ; 3260.0bp to feature; MODIFIER silent_mutation Average:74.853; most accessible tissue: Callus, score: 95.7 N N N N
vg0133688513 C -> T LOC_Os01g58280.1 downstream_gene_variant ; 288.0bp to feature; MODIFIER silent_mutation Average:74.853; most accessible tissue: Callus, score: 95.7 N N N N
vg0133688513 C -> T LOC_Os01g58280-LOC_Os01g58290 intergenic_region ; MODIFIER silent_mutation Average:74.853; most accessible tissue: Callus, score: 95.7 N N N N
vg0133688513 C -> DEL N N silent_mutation Average:74.853; most accessible tissue: Callus, score: 95.7 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0133688513 C T -0.05 -0.06 0.0 -0.03 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133688513 NA 4.80E-24 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 4.44E-07 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 2.69E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 5.82E-26 3.28E-149 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 4.67E-20 2.18E-30 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 3.61E-25 3.64E-146 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 2.09E-21 3.36E-30 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 1.97E-15 2.65E-91 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 1.11E-11 2.45E-13 mr1014 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 5.22E-18 2.68E-96 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 5.17E-13 3.02E-14 mr1015 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 1.93E-06 9.52E-69 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 1.09E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 9.68E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 9.36E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 1.19E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 6.83E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 9.46E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 1.16E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 2.38E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 5.63E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 2.99E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 6.24E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 3.08E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 6.07E-23 1.23E-146 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 1.12E-08 3.25E-21 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 8.58E-10 5.67E-10 mr1008_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 6.45E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 4.22E-10 1.57E-97 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 3.87E-08 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 6.90E-07 6.90E-07 mr1015_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 1.27E-07 NA mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 7.08E-07 2.34E-30 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133688513 NA 8.00E-07 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251